View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3543_low_1 (Length: 407)
Name: NF3543_low_1
Description: NF3543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3543_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 7e-62; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 25 - 169
Target Start/End: Complemental strand, 26869275 - 26869131
Alignment:
| Q |
25 |
gtgcaagatgacgttctgttggttgatactttagttaatcatcttcatgctgaatggtctaaaggagctaataatgataattgtcagtaacagaagaagg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||| |||| ||||| ||| |
|
|
| T |
26869275 |
gtgcaagatgacgttctgttggttgatactttagttaaccatcttcatgctgaatggtctagaggagttaataatgataattgtcggtaatagaaggagg |
26869176 |
T |
|
| Q |
125 |
ataaattctttattttgtctagatgtagttttgtagttctcttcc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26869175 |
ataaattctttattttgtctagatgtagttttgtagttctcttcc |
26869131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 249 - 296
Target Start/End: Complemental strand, 26869048 - 26869001
Alignment:
| Q |
249 |
tgctgaagcgttttggtgtggtttttaatatatctctttagccttttc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26869048 |
tgctgaagcgttttggtgtggtttttaatatatctctttagccttttc |
26869001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 352 - 393
Target Start/End: Complemental strand, 26868945 - 26868904
Alignment:
| Q |
352 |
caattaggattgacatttatatcatccttttttgctctaaat |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26868945 |
caattaggattgacatttatatcatccttttttgctctaaat |
26868904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University