View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3544_high_14 (Length: 251)
Name: NF3544_high_14
Description: NF3544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3544_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 104 - 241
Target Start/End: Complemental strand, 7131381 - 7131244
Alignment:
| Q |
104 |
ttctcaatggttatatatagtcgtgttttctctatatcgatgatttatctttgttgtattgcttttccaatgtaaaactctgagattaacattttgattt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7131381 |
ttctcaatggttatatatagtcgtgttttctctatatcgatgatttatctttgttgtattgcttttccaatgtaaaactctgaaattaacattttgattt |
7131282 |
T |
 |
| Q |
204 |
taataagttcttgtacaccgaggataaattcatctgtg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7131281 |
taataagttcttgtacaccgaggataaattcatctgtg |
7131244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University