View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3544_low_21 (Length: 212)

Name: NF3544_low_21
Description: NF3544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3544_low_21
NF3544_low_21
[»] chr8 (2 HSPs)
chr8 (122-196)||(13213480-13213553)
chr8 (1-51)||(13213622-13213672)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 122 - 196
Target Start/End: Complemental strand, 13213553 - 13213480
Alignment:
122 ctccaaaccttgaactaccatctctttactttacttccataaaaataaaagtagcttagctagctagtttcatat 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
13213553 ctccaaaccttgaactaccatctctttactttacttccataaaaa-aaaagtagcttagctagctagtttcatat 13213480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 13213672 - 13213622
Alignment:
1 atcctcaatctcattattattaaaccgcataaacaaaagcttcctaagttg 51  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
13213672 atcctcaatctcattattattaaaccgcataaacaaaagcttcctaagttg 13213622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University