View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_high_42 (Length: 297)
Name: NF3545_high_42
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 15468740 - 15468450
Alignment:
| Q |
1 |
aagtcccccttagtgtctacacattaatttattggtgctcataatcaaatattccactgaaaccatatttgaaacttgaagaaatgtgcgaatcatatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15468740 |
aagtcccccttagtgtctacacattaatttattggtgctcataatcaaatattccactaaaaccacatttgaaacttgaagaaatgtgcgaatcatatca |
15468641 |
T |
 |
| Q |
101 |
tttttcatttgcatggtttgattggtattattcttgaccatatatttgcattgaaaccatatttgaaacttggagttattttatcatctttgaaatttga |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15468640 |
tttttcatttgcacggtttgattggtattattcttgaccatatatttgcactgaaaccatatttgaaacttgaagttattttatcatctttgaaatttga |
15468541 |
T |
 |
| Q |
201 |
atagtagtatataggccacaatttcatccacgcaatgagagttttctataagaagacggcaccattattccattgatcttgcctttgcttc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15468540 |
atagtagtatataggccacaatttcatccacgcaatgagagttttctataagaagacggcaccattattccattgatcttgcccttgcttc |
15468450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 148
Target Start/End: Original strand, 15465478 - 15465509
Alignment:
| Q |
117 |
tttgattggtattattcttgaccatatatttg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15465478 |
tttgattggtattattcttgaccatatatttg |
15465509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University