View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_high_79 (Length: 234)
Name: NF3545_high_79
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_high_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 39300149 - 39299917
Alignment:
| Q |
1 |
caagagagactcatgaacttggttcaaatgtgaagcagagtgatagggatcatcatcatgctgctgctaccaaccttggacacaaacaaggttttcagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
39300149 |
caagagagactcatgaacttggttcaaatgtgaagcagagtgatagggatcatcatcatgctgctgctacgaaccttggtcacaagcaaggttttcagtc |
39300050 |
T |
 |
| Q |
101 |
tcactctgatcaaaatgtgaaacagagtgagagggatcgtcatcatgctacaaatgtagttggacacagacaaggtgcagaaggcatgaaagaaagaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300049 |
tcactctgatcaaaatgtgaaacagagtgagagggatcgtcatcatgctacaaatgtagttggacacagacaaggtgcagaaggcatgaaagaaagaggt |
39299950 |
T |
 |
| Q |
201 |
gaaggtttgggagatattggtggaagaggaaga |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39299949 |
gaaggtttgggagatattggtggaagaggaaga |
39299917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University