View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_high_81 (Length: 222)
Name: NF3545_high_81
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_high_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 22764684 - 22764491
Alignment:
| Q |
20 |
cttgcttctcatggaaagcctattgcagcaatcgagaacgtgttatatctagtctttcgaactacggtgacattagccatgtt---cctcttccaccccc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22764684 |
cttgcttctcatggaaagcctattgcagcaatctagaacgtgttatatctagtctttcgaactacggtgacattagccatgttgttcctcttccacccc- |
22764586 |
T |
 |
| Q |
117 |
aagtccttgtttgaaaaattcagaaggatttctaatttttacttcttagtatgtgcagtatttgactttcttttttgttgctccttacctttgct |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22764585 |
aagtccttgtttgaaaaattcagaagggtttctaatttttacttcttagtatgtgcagtatttgactttcttttttgttgctccttacttttgct |
22764491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 24330520 - 24330588
Alignment:
| Q |
20 |
cttgcttctcatggaaagcctattgcagcaatcgagaacgtgttatatctagtctttcgaactacggtg |
88 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||| ||||| |||||| |||||||||| |||||| |||| |
|
|
| T |
24330520 |
cttgcttctcatgaaaaacctattgcagcgatccagaacatgttatgtctagtcttttgaactatggtg |
24330588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University