View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3545_high_86 (Length: 210)

Name: NF3545_high_86
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3545_high_86
NF3545_high_86
[»] chr6 (2 HSPs)
chr6 (15-110)||(35095932-35096027)
chr6 (161-194)||(35095848-35095881)


Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 15 - 110
Target Start/End: Complemental strand, 35096027 - 35095932
Alignment:
15 aatatgcaattccatctctctccaccttccattgctgttcttgatcaacctcagtaacatctcatcttccttctatcgctgcacgccgcaccttaa 110  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
35096027 aatatgcaattccatctctctccaccttccatagctgttcttgatcaacctcagtaacatctcatcttccttctagcgctgcacgccgcaccttaa 35095932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 161 - 194
Target Start/End: Complemental strand, 35095881 - 35095848
Alignment:
161 ccttcactatattttattattatggcaccatcat 194  Q
    ||||||||||||||||||||||||||||||||||    
35095881 ccttcactatattttattattatggcaccatcat 35095848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University