View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_high_86 (Length: 210)
Name: NF3545_high_86
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_high_86 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 15 - 110
Target Start/End: Complemental strand, 35096027 - 35095932
Alignment:
| Q |
15 |
aatatgcaattccatctctctccaccttccattgctgttcttgatcaacctcagtaacatctcatcttccttctatcgctgcacgccgcaccttaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35096027 |
aatatgcaattccatctctctccaccttccatagctgttcttgatcaacctcagtaacatctcatcttccttctagcgctgcacgccgcaccttaa |
35095932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 161 - 194
Target Start/End: Complemental strand, 35095881 - 35095848
Alignment:
| Q |
161 |
ccttcactatattttattattatggcaccatcat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35095881 |
ccttcactatattttattattatggcaccatcat |
35095848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University