View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_20 (Length: 447)
Name: NF3545_low_20
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_20 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] chr6 (38 HSPs) |
 |  |
|
| [»] chr4 (68 HSPs) |
 |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |
|
| [»] chr8 (56 HSPs) |
 |  |
|
| [»] scaffold0474 (1 HSPs) |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |
|
| [»] chr3 (70 HSPs) |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |
|
| [»] scaffold0213 (1 HSPs) |
 |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |
|
| [»] scaffold0693 (1 HSPs) |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |
|
| [»] scaffold0370 (2 HSPs) |
 |  |
|
| [»] scaffold0272 (1 HSPs) |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0182 (1 HSPs) |
 |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 4e-42; HSPs: 56)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 143 - 234
Target Start/End: Original strand, 15060009 - 15060100
Alignment:
| Q |
143 |
ccctaaaattttgactaataatagatgatattcttatgctttgtttgggaatttggaggtgagaaatatcaaaaatagaaaaaactttcaca |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15060009 |
ccctaaaattttgactaataatcgatgatattcttatgctttgtttgggaatttggaggtgagaaatatcaaaaatagaaaaaactttcaca |
15060100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 143 - 234
Target Start/End: Original strand, 15058271 - 15058362
Alignment:
| Q |
143 |
ccctaaaattttgactaataatagatgatattcttatgctttgtttgggaatttggaggtgagaaatatcaaaaatagaaaaaactttcaca |
234 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15058271 |
ccctaaaattttgactaatgatcgatgatattcttatgctttttttggaaatttggaggtgagaaatatcaaaaatagaaaaaactttcaca |
15058362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 327 - 418
Target Start/End: Original strand, 15058453 - 15058544
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaattttgagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15058453 |
tcatataaactctctaaaattcctaaaaaccttctcccaatacaattttgagttcctcaaatgagggtaattttgtactatgaataaaaaat |
15058544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 327 - 418
Target Start/End: Original strand, 15061917 - 15062007
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaattttgagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15061917 |
tcatataaaccatctaaaactcctaaaaatcttctcccaatacaattttgagtt-ctcaaataaggggaattttgtactatgaataaaaaat |
15062007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 85 - 139
Target Start/End: Original strand, 15058169 - 15058223
Alignment:
| Q |
85 |
gaatatttaaaccctaatgttttgggctccctgcgccggatcaaatttattattt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15058169 |
gaatatttaaaccctaatgttttgggctccctgcgctggatcaaatttattattt |
15058223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 85 - 139
Target Start/End: Original strand, 15059904 - 15059958
Alignment:
| Q |
85 |
gaatatttaaaccctaatgttttgggctccctgcgccggatcaaatttattattt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15059904 |
gaatatttaaaccctaatgttttgggctccctgcgctggatcaaatttattattt |
15059958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 447
Target Start/End: Complemental strand, 223213 - 223179
Alignment:
| Q |
413 |
aaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
223213 |
aaaaatggcttaattgcacttttggacccctatct |
223179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 327 - 418
Target Start/End: Original strand, 37508398 - 37508492
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcct-aaaaaccttctcccactacaatttt-gagttcctc-aaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| || ||||||| || |||| ||||||||| ||||||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
37508398 |
tcatataaaccctccataaccccccaaaaaccctcccccaatacaatttttgagttcctccaaatgaggggaattttttattatgaataaaaaat |
37508492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 406 - 447
Target Start/End: Complemental strand, 34082427 - 34082386
Alignment:
| Q |
406 |
atgaataaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
34082427 |
atgaataaataaaggcttaattgcacttttggacccctatct |
34082386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 327 - 418
Target Start/End: Complemental strand, 2021053 - 2020961
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| ||| |||||| || |||| ||||||||| ||||||||| || |||||| ||||| || ||||| |||||||| |
|
|
| T |
2021053 |
tcatataaaccctccataacccctcaaaaccctcccccaatacaatttttgagttcctccaaagagggggattttttattatgagtaaaaaat |
2020961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 4125437 - 4125472
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4125437 |
aaaaaaaggcttaattgcacttttggacccctatct |
4125472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 12049112 - 12049147
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12049112 |
aaaaaaaggcttaattgcacttttggacccctatct |
12049147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 14647689 - 14647724
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14647689 |
aaaaaaaggcttaattgcacttttggacccctatct |
14647724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 23263138 - 23263173
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23263138 |
aaaaaaaggcttaattgcacttttggacccctatct |
23263173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Complemental strand, 34606690 - 34606655
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34606690 |
aaaaaaaggcttaattgcacttttggacccctatct |
34606655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 406 - 447
Target Start/End: Complemental strand, 16666900 - 16666858
Alignment:
| Q |
406 |
atgaataaaa-aatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
16666900 |
atgaataaaataaaggcttaattgcacttttggacccctatct |
16666858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 8339958 - 8339987
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8339958 |
tggcttaattgcacttttggacccctatct |
8339987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 23502442 - 23502413
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23502442 |
tggcttaattgcacttttggacccctatct |
23502413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 26323689 - 26323660
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26323689 |
tggcttaattgcacttttggacccctatct |
26323660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 34169102 - 34169073
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34169102 |
tggcttaattgcacttttggacccctatct |
34169073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 42739901 - 42739872
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42739901 |
tggcttaattgcacttttggacccctatct |
42739872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 1055681 - 1055653
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1055681 |
ggcttaattgcacttttggacccctatct |
1055653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 2710340 - 2710368
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2710340 |
ggcttaattgcacttttggacccctatct |
2710368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 2710650 - 2710622
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2710650 |
ggcttaattgcacttttggacccctatct |
2710622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 3020907 - 3020879
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3020907 |
ggcttaattgcacttttggacccctatct |
3020879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 3223436 - 3223464
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3223436 |
ggcttaattgcacttttggacccctatct |
3223464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 3223597 - 3223569
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3223597 |
ggcttaattgcacttttggacccctatct |
3223569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 5088074 - 5088102
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5088074 |
ggcttaattgcacttttggacccctatct |
5088102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 5088385 - 5088357
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5088385 |
ggcttaattgcacttttggacccctatct |
5088357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 8986923 - 8986895
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8986923 |
ggcttaattgcacttttggacccctatct |
8986895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 9071968 - 9071996
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9071968 |
ggcttaattgcacttttggacccctatct |
9071996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 11480036 - 11480064
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11480036 |
ggcttaattgcacttttggacccctatct |
11480064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 11709452 - 11709424
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11709452 |
ggcttaattgcacttttggacccctatct |
11709424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 13765574 - 13765546
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13765574 |
ggcttaattgcacttttggacccctatct |
13765546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 15526704 - 15526732
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15526704 |
ggcttaattgcacttttggacccctatct |
15526732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 16521154 - 16521182
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16521154 |
ggcttaattgcacttttggacccctatct |
16521182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 18266352 - 18266380
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18266352 |
ggcttaattgcacttttggacccctatct |
18266380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 25631086 - 25631114
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25631086 |
ggcttaattgcacttttggacccctatct |
25631114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 27264109 - 27264137
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27264109 |
ggcttaattgcacttttggacccctatct |
27264137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 28394933 - 28394961
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28394933 |
ggcttaattgcacttttggacccctatct |
28394961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 28620039 - 28620067
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28620039 |
ggcttaattgcacttttggacccctatct |
28620067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 29401402 - 29401374
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29401402 |
ggcttaattgcacttttggacccctatct |
29401374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 30894125 - 30894153
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30894125 |
ggcttaattgcacttttggacccctatct |
30894153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 31172568 - 31172596
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31172568 |
ggcttaattgcacttttggacccctatct |
31172596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 31456174 - 31456146
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31456174 |
ggcttaattgcacttttggacccctatct |
31456146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 34734386 - 34734358
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34734386 |
ggcttaattgcacttttggacccctatct |
34734358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 35306710 - 35306738
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35306710 |
ggcttaattgcacttttggacccctatct |
35306738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 35307015 - 35306987
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35307015 |
ggcttaattgcacttttggacccctatct |
35306987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 35818483 - 35818455
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35818483 |
ggcttaattgcacttttggacccctatct |
35818455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 37333854 - 37333818
Alignment:
| Q |
411 |
taaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
37333854 |
taaaaaaaggcttaattgcacttttggacccttatct |
37333818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 40297665 - 40297693
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40297665 |
ggcttaattgcacttttggacccctatct |
40297693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 40687666 - 40687694
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40687666 |
ggcttaattgcacttttggacccctatct |
40687694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 40687982 - 40687954
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40687982 |
ggcttaattgcacttttggacccctatct |
40687954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 40768201 - 40768173
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40768201 |
ggcttaattgcacttttggacccctatct |
40768173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 41140427 - 41140399
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41140427 |
ggcttaattgcacttttggacccctatct |
41140399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 43586099 - 43586071
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43586099 |
ggcttaattgcacttttggacccctatct |
43586071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000003; HSPs: 61)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 327 - 418
Target Start/End: Complemental strand, 13255417 - 13255324
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaa-ttttgagtt-cctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||||| ||| || |||||| ||||||||||||| ||||||||| || ||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
13255417 |
tcatataaaccctctataaccccccaaaaccctctcccactacaatttttgagttcccccaaatgagggggattttttattatgagtaaaaaat |
13255324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 412 - 444
Target Start/End: Original strand, 6742849 - 6742881
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggaccccta |
444 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6742849 |
aaaaaatggcttaattgcacttttggaccccta |
6742881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 327 - 417
Target Start/End: Original strand, 47905697 - 47905789
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcctc-aaatgaggggaattttgtactatgaataaaaaa |
417 |
Q |
| |
|
|||||||||||||| | ||| || ||||||| || |||| ||||||||| ||||||| | |||||||||||||||| || ||||| ||||||| |
|
|
| T |
47905697 |
tcatataaaccctccataacccccaaaaaccctcccccaatacaatttttgagttcccccaaatgaggggaattttttattatgagtaaaaaa |
47905789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Complemental strand, 32341812 - 32341777
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32341812 |
aaaaaaaggcttaattgcacttttggacccctatct |
32341777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 39427404 - 39427439
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39427404 |
aaaaaaaggcttaattgcacttttggacccctatct |
39427439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 43914571 - 43914606
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43914571 |
aaaaaaaggcttaattgcacttttggacccctatct |
43914606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 447
Target Start/End: Original strand, 12690015 - 12690049
Alignment:
| Q |
413 |
aaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12690015 |
aaaaaaggcttaattgcacttttggacccctatct |
12690049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 417
Target Start/End: Complemental strand, 50476565 - 50476519
Alignment:
| Q |
372 |
ttttgagttcc-tcaaatgaggggaattttgtactatgaataaaaaa |
417 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
50476565 |
ttttgagttccctcaaatgagggggattttgtattatgaataaaaaa |
50476519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 2371176 - 2371205
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2371176 |
tggcttaattgcacttttggacccctatct |
2371205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 2371491 - 2371462
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2371491 |
tggcttaattgcacttttggacccctatct |
2371462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 3263999 - 3264028
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3263999 |
tggcttaattgcacttttggacccctatct |
3264028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 6182981 - 6183010
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6182981 |
tggcttaattgcacttttggacccctatct |
6183010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 6183296 - 6183267
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6183296 |
tggcttaattgcacttttggacccctatct |
6183267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 6491730 - 6491701
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6491730 |
tggcttaattgcacttttggacccctatct |
6491701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Complemental strand, 8774615 - 8774582
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
8774615 |
aaaatggcttaattgcacttttggacccttatct |
8774582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 9058165 - 9058194
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9058165 |
tggcttaattgcacttttggacccctatct |
9058194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 13791889 - 13791860
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13791889 |
tggcttaattgcacttttggacccctatct |
13791860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 22075665 - 22075636
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22075665 |
tggcttaattgcacttttggacccctatct |
22075636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 23793096 - 23793067
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23793096 |
tggcttaattgcacttttggacccctatct |
23793067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 26435004 - 26434975
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26435004 |
tggcttaattgcacttttggacccctatct |
26434975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 28503450 - 28503421
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28503450 |
tggcttaattgcacttttggacccctatct |
28503421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 30294869 - 30294898
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30294869 |
tggcttaattgcacttttggacccctatct |
30294898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 32341494 - 32341523
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32341494 |
tggcttaattgcacttttggacccctatct |
32341523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 38622717 - 38622688
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38622717 |
tggcttaattgcacttttggacccctatct |
38622688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 42407199 - 42407170
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42407199 |
tggcttaattgcacttttggacccctatct |
42407170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 447
Target Start/End: Original strand, 45884939 - 45884976
Alignment:
| Q |
411 |
taaaaaat-ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45884939 |
taaaaaataggcttaattgcacttttggacccctatct |
45884976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 52149828 - 52149799
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52149828 |
tggcttaattgcacttttggacccctatct |
52149799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 922476 - 922448
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
922476 |
ggcttaattgcacttttggacccctatct |
922448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 327 - 418
Target Start/End: Original strand, 1688225 - 1688317
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| || ||||| || |||| ||||||||| ||||||| ||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
1688225 |
tcatataaaccctccataaccccccaaaactctcccccaatacaatttttgagttccccaaatgagggggattttttattatgagtaaaaaat |
1688317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 352 - 418
Target Start/End: Complemental strand, 7964022 - 7963954
Alignment:
| Q |
352 |
aaaaccttctcccactacaatttt-gagttcctc-aaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||| || |||| ||||||||| ||||||||| |||||||||| ||||| |||||||| |||||||| |
|
|
| T |
7964022 |
aaaaccctcccccaatacaatttttgagttcctccaaatgagggggattttttactatgagtaaaaaat |
7963954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 8770463 - 8770491
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8770463 |
ggcttaattgcacttttggacccctatct |
8770491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 8774298 - 8774326
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8774298 |
ggcttaattgcacttttggacccctatct |
8774326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 11018401 - 11018429
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11018401 |
ggcttaattgcacttttggacccctatct |
11018429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 11018715 - 11018687
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11018715 |
ggcttaattgcacttttggacccctatct |
11018687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 11051896 - 11051924
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11051896 |
ggcttaattgcacttttggacccctatct |
11051924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 11052210 - 11052182
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11052210 |
ggcttaattgcacttttggacccctatct |
11052182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 11204507 - 11204535
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11204507 |
ggcttaattgcacttttggacccctatct |
11204535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 15161611 - 15161583
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15161611 |
ggcttaattgcacttttggacccctatct |
15161583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 20017690 - 20017662
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20017690 |
ggcttaattgcacttttggacccctatct |
20017662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 20596176 - 20596148
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20596176 |
ggcttaattgcacttttggacccctatct |
20596148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 22204305 - 22204333
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22204305 |
ggcttaattgcacttttggacccctatct |
22204333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 23341964 - 23341992
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23341964 |
ggcttaattgcacttttggacccctatct |
23341992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 23342274 - 23342246
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23342274 |
ggcttaattgcacttttggacccctatct |
23342246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 23356693 - 23356721
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23356693 |
ggcttaattgcacttttggacccctatct |
23356721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 412 - 444
Target Start/End: Complemental strand, 25820873 - 25820841
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggaccccta |
444 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
25820873 |
aaaaaaaggcttaattgcacttttggaccccta |
25820841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 26861274 - 26861302
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26861274 |
ggcttaattgcacttttggacccctatct |
26861302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 27396839 - 27396811
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27396839 |
ggcttaattgcacttttggacccctatct |
27396811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 29794693 - 29794721
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29794693 |
ggcttaattgcacttttggacccctatct |
29794721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 30288176 - 30288204
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30288176 |
ggcttaattgcacttttggacccctatct |
30288204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 30295183 - 30295155
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30295183 |
ggcttaattgcacttttggacccctatct |
30295155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 31797064 - 31797092
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31797064 |
ggcttaattgcacttttggacccctatct |
31797092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 33777166 - 33777194
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33777166 |
ggcttaattgcacttttggacccctatct |
33777194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 37028928 - 37028956
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37028928 |
ggcttaattgcacttttggacccctatct |
37028956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 38622403 - 38622431
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38622403 |
ggcttaattgcacttttggacccctatct |
38622431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 43914893 - 43914865
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43914893 |
ggcttaattgcacttttggacccctatct |
43914865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 45012632 - 45012660
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45012632 |
ggcttaattgcacttttggacccctatct |
45012660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 45664453 - 45664425
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45664453 |
ggcttaattgcacttttggacccctatct |
45664425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 45885262 - 45885234
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45885262 |
ggcttaattgcacttttggacccctatct |
45885234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 47113700 - 47113672
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47113700 |
ggcttaattgcacttttggacccctatct |
47113672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 52143478 - 52143450
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52143478 |
ggcttaattgcacttttggacccctatct |
52143450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 52233431 - 52233459
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52233431 |
ggcttaattgcacttttggacccctatct |
52233459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 327 - 418
Target Start/End: Original strand, 35463 - 35555
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| || |||||| || |||| ||||||||| ||||||| ||||||||||||||||| || ||||| |||||||| |
|
|
| T |
35463 |
tcatataaaccctccataaccccccaaaaccctcccccaatacaatttttgagttccccaaatgaggggaattttttattatgagtaaaaaat |
35555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 63)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 327 - 418
Target Start/End: Original strand, 42620360 - 42620452
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| ||| |||| | || |||| ||||||||| ||||||| ||||||||||||||||| || ||||| |||||||| |
|
|
| T |
42620360 |
tcatataaaccctccataacccctcaaaatcctcccccaatacaatttttgagttccccaaatgaggggaattttttattatgagtaaaaaat |
42620452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 3925786 - 3925821
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3925786 |
aaaaaaaggcttaattgcacttttggacccctatct |
3925821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 10318884 - 10318919
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10318884 |
aaaaaaaggcttaattgcacttttggacccctatct |
10318919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 329 - 418
Target Start/End: Original strand, 33406642 - 33406733
Alignment:
| Q |
329 |
atataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcc-tcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||| | ||| || |||||| ||||||| ||||||||| ||||||| |||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
33406642 |
atataaaccctccataaccccccaaaaccctctcccaatacaatttttgagttccctcaaatgagggggattttttattatgagtaaaaaat |
33406733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 447
Target Start/End: Complemental strand, 27513120 - 27513086
Alignment:
| Q |
413 |
aaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27513120 |
aaaaaaggcttaattgcacttttggacccctatct |
27513086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Original strand, 45231520 - 45231550
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45231520 |
atggcttaattgcacttttggacccctatct |
45231550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 388215 - 388186
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
388215 |
tggcttaattgcacttttggacccctatct |
388186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 10319207 - 10319178
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10319207 |
tggcttaattgcacttttggacccctatct |
10319178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 10385763 - 10385734
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10385763 |
tggcttaattgcacttttggacccctatct |
10385734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 19233633 - 19233604
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19233633 |
tggcttaattgcacttttggacccctatct |
19233604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 24775939 - 24775910
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24775939 |
tggcttaattgcacttttggacccctatct |
24775910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 30699338 - 30699309
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30699338 |
tggcttaattgcacttttggacccctatct |
30699309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Complemental strand, 35924209 - 35924176
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
35924209 |
aaaaaggcttaattgcacttttggacccctatct |
35924176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 38445720 - 38445691
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38445720 |
tggcttaattgcacttttggacccctatct |
38445691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 39976728 - 39976757
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39976728 |
tggcttaattgcacttttggacccctatct |
39976757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Original strand, 40436031 - 40436064
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
40436031 |
aaaaaggcttaattgcacttttggacccctatct |
40436064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Complemental strand, 43408522 - 43408489
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
43408522 |
aaaaaggcttaattgcacttttggacccctatct |
43408489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 327 - 418
Target Start/End: Original strand, 43778584 - 43778677
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaattttg-agttcct-caaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| || |||||| || |||| ||||||||| ||||||| ||||||||||||||||| || ||||| |||||||| |
|
|
| T |
43778584 |
tcatataaaccctccataaccccccaaaaccctcccccaatacaattttttagttccttcaaatgaggggaattttttattatgagtaaaaaat |
43778677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 415 - 447
Target Start/End: Original strand, 930704 - 930736
Alignment:
| Q |
415 |
aaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
930704 |
aaatggcttaattacacttttggacccctatct |
930736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 931021 - 930993
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
931021 |
ggcttaattgcacttttggacccctatct |
930993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 3235429 - 3235401
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3235429 |
ggcttaattgcacttttggacccctatct |
3235401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 5096788 - 5096816
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5096788 |
ggcttaattgcacttttggacccctatct |
5096816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 7974704 - 7974676
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7974704 |
ggcttaattgcacttttggacccctatct |
7974676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 11900050 - 11900078
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11900050 |
ggcttaattgcacttttggacccctatct |
11900078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 11900363 - 11900335
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11900363 |
ggcttaattgcacttttggacccctatct |
11900335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 16879551 - 16879523
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16879551 |
ggcttaattgcacttttggacccctatct |
16879523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 18296164 - 18296136
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18296164 |
ggcttaattgcacttttggacccctatct |
18296136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 18363607 - 18363579
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18363607 |
ggcttaattgcacttttggacccctatct |
18363579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 18852495 - 18852523
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18852495 |
ggcttaattgcacttttggacccctatct |
18852523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 18852806 - 18852778
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18852806 |
ggcttaattgcacttttggacccctatct |
18852778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 19194160 - 19194188
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19194160 |
ggcttaattgcacttttggacccctatct |
19194188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 19778567 - 19778539
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19778567 |
ggcttaattgcacttttggacccctatct |
19778539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 21782603 - 21782631
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21782603 |
ggcttaattgcacttttggacccctatct |
21782631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 21917563 - 21917535
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21917563 |
ggcttaattgcacttttggacccctatct |
21917535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 23909895 - 23909923
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23909895 |
ggcttaattgcacttttggacccctatct |
23909923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 25683988 - 25683960
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25683988 |
ggcttaattgcacttttggacccctatct |
25683960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 25982989 - 25983017
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25982989 |
ggcttaattgcacttttggacccctatct |
25983017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 25986925 - 25986953
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25986925 |
ggcttaattgcacttttggacccctatct |
25986953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 26612342 - 26612370
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26612342 |
ggcttaattgcacttttggacccctatct |
26612370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 26612656 - 26612628
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26612656 |
ggcttaattgcacttttggacccctatct |
26612628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 27432490 - 27432518
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27432490 |
ggcttaattgcacttttggacccctatct |
27432518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 27512802 - 27512830
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27512802 |
ggcttaattgcacttttggacccctatct |
27512830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 30141233 - 30141205
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30141233 |
ggcttaattgcacttttggacccctatct |
30141205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 30757224 - 30757252
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30757224 |
ggcttaattgcacttttggacccctatct |
30757252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 32555614 - 32555586
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32555614 |
ggcttaattgcacttttggacccctatct |
32555586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 34288048 - 34288076
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34288048 |
ggcttaattgcacttttggacccctatct |
34288076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 34533214 - 34533242
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34533214 |
ggcttaattgcacttttggacccctatct |
34533242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 34533526 - 34533498
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34533526 |
ggcttaattgcacttttggacccctatct |
34533498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 35121726 - 35121698
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35121726 |
ggcttaattgcacttttggacccctatct |
35121698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 35437527 - 35437499
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35437527 |
ggcttaattgcacttttggacccctatct |
35437499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 35711659 - 35711687
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35711659 |
ggcttaattgcacttttggacccctatct |
35711687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 36376060 - 36376088
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36376060 |
ggcttaattgcacttttggacccctatct |
36376088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 37452362 - 37452334
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37452362 |
ggcttaattgcacttttggacccctatct |
37452334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 37996017 - 37996045
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37996017 |
ggcttaattgcacttttggacccctatct |
37996045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 38053146 - 38053174
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38053146 |
ggcttaattgcacttttggacccctatct |
38053174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 38879463 - 38879435
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38879463 |
ggcttaattgcacttttggacccctatct |
38879435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 38882687 - 38882659
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38882687 |
ggcttaattgcacttttggacccctatct |
38882659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 39753872 - 39753900
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39753872 |
ggcttaattgcacttttggacccctatct |
39753900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 42997056 - 42997084
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42997056 |
ggcttaattgcacttttggacccctatct |
42997084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 43632341 - 43632369
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43632341 |
ggcttaattgcacttttggacccctatct |
43632369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 44214659 - 44214687
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44214659 |
ggcttaattgcacttttggacccctatct |
44214687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 46622554 - 46622582
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46622554 |
ggcttaattgcacttttggacccctatct |
46622582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 47731702 - 47731730
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47731702 |
ggcttaattgcacttttggacccctatct |
47731730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 35)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 327 - 418
Target Start/End: Original strand, 13765947 - 13766039
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| || |||||| || |||| ||||||||| ||||||| ||||||||||||||||| || ||||| |||||||| |
|
|
| T |
13765947 |
tcatataaaccctccacaaccccccaaaaccctcccccaatacaatttttgagttccccaaatgaggggaattttttattatgagtaaaaaat |
13766039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 447
Target Start/End: Complemental strand, 36987729 - 36987698
Alignment:
| Q |
416 |
aatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36987729 |
aatggcttaattgcacttttggacccctatct |
36987698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 447
Target Start/End: Original strand, 38731276 - 38731307
Alignment:
| Q |
416 |
aatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38731276 |
aatggcttaattgcacttttggacccctatct |
38731307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 447
Target Start/End: Complemental strand, 1375480 - 1375446
Alignment:
| Q |
413 |
aaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1375480 |
aaaaatgacttaattgcacttttggacccctatct |
1375446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 410 - 447
Target Start/End: Complemental strand, 19256912 - 19256874
Alignment:
| Q |
410 |
ataaaaaat-ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19256912 |
ataaaaaataggcttaattgcacttttggacccctatct |
19256874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Original strand, 20494337 - 20494367
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20494337 |
atggcttaattgcacttttggacccctatct |
20494367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Original strand, 40493644 - 40493674
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40493644 |
atggcttaattgcacttttggacccctatct |
40493674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 409 - 447
Target Start/End: Complemental strand, 40493968 - 40493930
Alignment:
| Q |
409 |
aataaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
40493968 |
aataaaataaggcttaattgcacttttggacccctatct |
40493930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 1375045 - 1375074
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1375045 |
tggcttaattgcacttttggacccctatct |
1375074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 1466809 - 1466838
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1466809 |
tggcttaattgcacttttggacccctatct |
1466838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 327 - 418
Target Start/End: Complemental strand, 4042037 - 4041944
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcct-caaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| || |||||| || |||| ||||||||| |||||||| ||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
4042037 |
tcatataaaccctccataaccccccaaaaccctcccccaatacaatttttgagttccttcaaatgagggggattttttattatgagtaaaaaat |
4041944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 17798847 - 17798876
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17798847 |
tggcttaattgcacttttggacccctatct |
17798876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 21552540 - 21552569
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21552540 |
tggcttaattgcacttttggacccctatct |
21552569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 22194762 - 22194733
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22194762 |
tggcttaattgcacttttggacccctatct |
22194733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Original strand, 24205289 - 24205322
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
24205289 |
aaaaaggcttaattgcacttttggacccctatct |
24205322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Complemental strand, 32661753 - 32661720
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
32661753 |
aaaatggcttaattgcacttttggccccctatct |
32661720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 34850971 - 34850942
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34850971 |
tggcttaattgcacttttggacccctatct |
34850942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 36987411 - 36987440
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36987411 |
tggcttaattgcacttttggacccctatct |
36987440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 39642728 - 39642757
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39642728 |
tggcttaattgcacttttggacccctatct |
39642757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 1467121 - 1467093
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1467121 |
ggcttaattgcacttttggacccctatct |
1467093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 3263035 - 3263063
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3263035 |
ggcttaattgcacttttggacccctatct |
3263063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 9715162 - 9715134
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9715162 |
ggcttaattgcacttttggacccctatct |
9715134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 20436058 - 20436086
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20436058 |
ggcttaattgcacttttggacccctatct |
20436086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 23000822 - 23000794
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23000822 |
ggcttaattgcacttttggacccctatct |
23000794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 24895224 - 24895196
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24895224 |
ggcttaattgcacttttggacccctatct |
24895196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 25429922 - 25429950
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25429922 |
ggcttaattgcacttttggacccctatct |
25429950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 25430083 - 25430055
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25430083 |
ggcttaattgcacttttggacccctatct |
25430055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 25888204 - 25888176
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25888204 |
ggcttaattgcacttttggacccctatct |
25888176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 26717158 - 26717186
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26717158 |
ggcttaattgcacttttggacccctatct |
26717186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 30219019 - 30218991
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30219019 |
ggcttaattgcacttttggacccctatct |
30218991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 31784252 - 31784280
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31784252 |
ggcttaattgcacttttggacccctatct |
31784280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 33004709 - 33004737
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33004709 |
ggcttaattgcacttttggacccctatct |
33004737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 327 - 418
Target Start/End: Complemental strand, 38293961 - 38293869
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaatttt-gagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
|||||||||||||| | ||| | ||||||| || |||| ||||||||| ||||||| |||||||||| ||||| || ||||| |||||||| |
|
|
| T |
38293961 |
tcatataaaccctccataacctccaaaaaccctcccccaatacaatttttgagttccccaaatgagggagattttttattatgagtaaaaaat |
38293869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 40445866 - 40445838
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40445866 |
ggcttaattgcacttttggacccctatct |
40445838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 45127149 - 45127121
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45127149 |
ggcttaattgcacttttggacccctatct |
45127121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 38)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 405 - 447
Target Start/End: Complemental strand, 6261704 - 6261662
Alignment:
| Q |
405 |
tatgaataaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6261704 |
tatgaataaaaataggcttaattgcacttttggacccctatct |
6261662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 10893882 - 10893917
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10893882 |
aaaaaaaggcttaattgcacttttggacccctatct |
10893917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Complemental strand, 13042728 - 13042693
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13042728 |
aaaatatggcttaattgcacttttggacccctatct |
13042693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 31740762 - 31740797
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31740762 |
aaaaaaaggcttaattgcacttttggacccctatct |
31740797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Complemental strand, 31833586 - 31833551
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31833586 |
aaaaaaaggcttaattgcacttttggacccctatct |
31833551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Original strand, 6261379 - 6261409
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6261379 |
atggcttaattgcacttttggacccctatct |
6261409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Complemental strand, 11746294 - 11746264
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11746294 |
atggcttaattgcacttttggacccctatct |
11746264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 1814975 - 1815004
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1814975 |
tggcttaattgcacttttggacccctatct |
1815004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 10977657 - 10977686
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10977657 |
tggcttaattgcacttttggacccctatct |
10977686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 23883402 - 23883373
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23883402 |
tggcttaattgcacttttggacccctatct |
23883373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 28930778 - 28930749
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28930778 |
tggcttaattgcacttttggacccctatct |
28930749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 34705690 - 34705661
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34705690 |
tggcttaattgcacttttggacccctatct |
34705661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 1815289 - 1815261
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1815289 |
ggcttaattgcacttttggacccctatct |
1815261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 1896898 - 1896926
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1896898 |
ggcttaattgcacttttggacccctatct |
1896926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 2100694 - 2100666
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2100694 |
ggcttaattgcacttttggacccctatct |
2100666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 2565078 - 2565106
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2565078 |
ggcttaattgcacttttggacccctatct |
2565106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 2565392 - 2565364
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2565392 |
ggcttaattgcacttttggacccctatct |
2565364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 4405554 - 4405526
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4405554 |
ggcttaattgcacttttggacccctatct |
4405526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 7391485 - 7391513
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7391485 |
ggcttaattgcacttttggacccctatct |
7391513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 9126688 - 9126660
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9126688 |
ggcttaattgcacttttggacccctatct |
9126660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 11213496 - 11213468
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11213496 |
ggcttaattgcacttttggacccctatct |
11213468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 11322338 - 11322310
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11322338 |
ggcttaattgcacttttggacccctatct |
11322310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 11614898 - 11614926
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11614898 |
ggcttaattgcacttttggacccctatct |
11614926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 11745998 - 11746026
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11745998 |
ggcttaattgcacttttggacccctatct |
11746026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 13042408 - 13042436
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13042408 |
ggcttaattgcacttttggacccctatct |
13042436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 14997322 - 14997294
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14997322 |
ggcttaattgcacttttggacccctatct |
14997294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 15272998 - 15273026
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15272998 |
ggcttaattgcacttttggacccctatct |
15273026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 16765350 - 16765322
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16765350 |
ggcttaattgcacttttggacccctatct |
16765322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 20080118 - 20080146
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20080118 |
ggcttaattgcacttttggacccctatct |
20080146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 23291256 - 23291284
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23291256 |
ggcttaattgcacttttggacccctatct |
23291284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 23585291 - 23585263
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23585291 |
ggcttaattgcacttttggacccctatct |
23585263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 25749955 - 25749983
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25749955 |
ggcttaattgcacttttggacccctatct |
25749983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 26171520 - 26171492
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26171520 |
ggcttaattgcacttttggacccctatct |
26171492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 26716684 - 26716656
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26716684 |
ggcttaattgcacttttggacccctatct |
26716656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 27223622 - 27223594
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27223622 |
ggcttaattgcacttttggacccctatct |
27223594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 29697156 - 29697128
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29697156 |
ggcttaattgcacttttggacccctatct |
29697128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 30965691 - 30965719
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30965691 |
ggcttaattgcacttttggacccctatct |
30965719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 31951514 - 31951486
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31951514 |
ggcttaattgcacttttggacccctatct |
31951486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 68)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 410 - 447
Target Start/End: Original strand, 7666191 - 7666228
Alignment:
| Q |
410 |
ataaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7666191 |
ataaaaaaaggcttaattgcacttttggacccctatct |
7666228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 447
Target Start/End: Complemental strand, 11159736 - 11159705
Alignment:
| Q |
416 |
aatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11159736 |
aatggcttaattgcacttttggacccctatct |
11159705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 447
Target Start/End: Original strand, 14578427 - 14578466
Alignment:
| Q |
409 |
aataaaaaat-ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14578427 |
aataaaaaataggcttaattgcacttttggacccctatct |
14578466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 447
Target Start/End: Original strand, 21536877 - 21536908
Alignment:
| Q |
416 |
aatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21536877 |
aatggcttaattgcacttttggacccctatct |
21536908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 51696529 - 51696564
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51696529 |
aaaaaaaggcttaattgcacttttggacccctatct |
51696564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Complemental strand, 18988495 - 18988465
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18988495 |
atggcttaattgcacttttggacccctatct |
18988465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 409 - 447
Target Start/End: Complemental strand, 39946400 - 39946362
Alignment:
| Q |
409 |
aataaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
39946400 |
aataaaagatggcttaattgcacttttggacccttatct |
39946362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 7666512 - 7666483
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7666512 |
tggcttaattgcacttttggacccctatct |
7666483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 10045955 - 10045984
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10045955 |
tggcttaattgcacttttggacccctatct |
10045984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Original strand, 11529754 - 11529787
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
11529754 |
aaaaaggcttaattgcacttttggacccctatct |
11529787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 13019272 - 13019301
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13019272 |
tggcttaattgcacttttggacccctatct |
13019301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 17262399 - 17262370
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17262399 |
tggcttaattgcacttttggacccctatct |
17262370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 17266061 - 17266032
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17266061 |
tggcttaattgcacttttggacccctatct |
17266032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 24415396 - 24415359
Alignment:
| Q |
411 |
taaaaaat-ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24415396 |
taaaaaataggcttaattgcacttttggacccctatct |
24415359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 27247173 - 27247144
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27247173 |
tggcttaattgcacttttggacccctatct |
27247144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 34363132 - 34363103
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34363132 |
tggcttaattgcacttttggacccctatct |
34363103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 35364195 - 35364224
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35364195 |
tggcttaattgcacttttggacccctatct |
35364224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Complemental strand, 41205814 - 41205781
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
41205814 |
aaaaaggcttaattgcacttttggacccctatct |
41205781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 43821718 - 43821747
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43821718 |
tggcttaattgcacttttggacccctatct |
43821747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Complemental strand, 52046034 - 52046001
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
52046034 |
aaaaaggcttaattgcacttttggacccctatct |
52046001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 104200 - 104228
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
104200 |
ggcttaattgcacttttggacccctatct |
104228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 233004 - 232976
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
233004 |
ggcttaattgcacttttggacccctatct |
232976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 3770179 - 3770207
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3770179 |
ggcttaattgcacttttggacccctatct |
3770207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 4902136 - 4902164
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4902136 |
ggcttaattgcacttttggacccctatct |
4902164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 4902469 - 4902441
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4902469 |
ggcttaattgcacttttggacccctatct |
4902441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 5344270 - 5344298
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5344270 |
ggcttaattgcacttttggacccctatct |
5344298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 6386731 - 6386759
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6386731 |
ggcttaattgcacttttggacccctatct |
6386759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 7396141 - 7396169
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7396141 |
ggcttaattgcacttttggacccctatct |
7396169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 7644457 - 7644485
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7644457 |
ggcttaattgcacttttggacccctatct |
7644485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 7705590 - 7705618
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7705590 |
ggcttaattgcacttttggacccctatct |
7705618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 9592452 - 9592416
Alignment:
| Q |
411 |
taaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
9592452 |
taaataatggcttaattgcacttttggccccctatct |
9592416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 10046249 - 10046221
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10046249 |
ggcttaattgcacttttggacccctatct |
10046221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 11530073 - 11530045
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11530073 |
ggcttaattgcacttttggacccctatct |
11530045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 12640820 - 12640848
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12640820 |
ggcttaattgcacttttggacccctatct |
12640848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 12641132 - 12641104
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12641132 |
ggcttaattgcacttttggacccctatct |
12641104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 13021292 - 13021264
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13021292 |
ggcttaattgcacttttggacccctatct |
13021264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 14578753 - 14578725
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14578753 |
ggcttaattgcacttttggacccctatct |
14578725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 407 - 447
Target Start/End: Original strand, 17554033 - 17554073
Alignment:
| Q |
407 |
tgaataaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| |||||| || |||||||||||||||||||||||||| |
|
|
| T |
17554033 |
tgaaaaaaaaaaggtttaattgcacttttggacccctatct |
17554073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 17554359 - 17554331
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17554359 |
ggcttaattgcacttttggacccctatct |
17554331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 18988179 - 18988207
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18988179 |
ggcttaattgcacttttggacccctatct |
18988207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 21537190 - 21537162
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21537190 |
ggcttaattgcacttttggacccctatct |
21537162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 23315691 - 23315663
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23315691 |
ggcttaattgcacttttggacccctatct |
23315663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 24415073 - 24415101
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24415073 |
ggcttaattgcacttttggacccctatct |
24415101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 24542754 - 24542782
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24542754 |
ggcttaattgcacttttggacccctatct |
24542782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 27246859 - 27246887
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27246859 |
ggcttaattgcacttttggacccctatct |
27246887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 29548493 - 29548465
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29548493 |
ggcttaattgcacttttggacccctatct |
29548465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 31250782 - 31250754
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31250782 |
ggcttaattgcacttttggacccctatct |
31250754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 33338343 - 33338315
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33338343 |
ggcttaattgcacttttggacccctatct |
33338315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 34362820 - 34362848
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34362820 |
ggcttaattgcacttttggacccctatct |
34362848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 35835776 - 35835804
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35835776 |
ggcttaattgcacttttggacccctatct |
35835804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 37289455 - 37289483
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37289455 |
ggcttaattgcacttttggacccctatct |
37289483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 38371271 - 38371299
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38371271 |
ggcttaattgcacttttggacccctatct |
38371299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 39136298 - 39136326
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39136298 |
ggcttaattgcacttttggacccctatct |
39136326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 39136610 - 39136582
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39136610 |
ggcttaattgcacttttggacccctatct |
39136582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 41205498 - 41205526
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41205498 |
ggcttaattgcacttttggacccctatct |
41205526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 41787049 - 41787077
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41787049 |
ggcttaattgcacttttggacccctatct |
41787077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 42672381 - 42672353
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42672381 |
ggcttaattgcacttttggacccctatct |
42672353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 43822011 - 43821983
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43822011 |
ggcttaattgcacttttggacccctatct |
43821983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 44921923 - 44921895
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44921923 |
ggcttaattgcacttttggacccctatct |
44921895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 45289813 - 45289785
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45289813 |
ggcttaattgcacttttggacccctatct |
45289785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 47821475 - 47821503
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47821475 |
ggcttaattgcacttttggacccctatct |
47821503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 47853976 - 47854004
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47853976 |
ggcttaattgcacttttggacccctatct |
47854004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 51537430 - 51537458
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51537430 |
ggcttaattgcacttttggacccctatct |
51537458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 52045721 - 52045749
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52045721 |
ggcttaattgcacttttggacccctatct |
52045749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 52310801 - 52310829
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52310801 |
ggcttaattgcacttttggacccctatct |
52310829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 52311115 - 52311087
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52311115 |
ggcttaattgcacttttggacccctatct |
52311087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 54215956 - 54215984
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54215956 |
ggcttaattgcacttttggacccctatct |
54215984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 55586930 - 55586902
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55586930 |
ggcttaattgcacttttggacccctatct |
55586902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 5914 - 5878
Alignment:
| Q |
411 |
taaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5914 |
taaaaaaaggcttaattgcacttttggacccctatct |
5878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 5592 - 5620
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5592 |
ggcttaattgcacttttggacccctatct |
5620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 56)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 4167521 - 4167485
Alignment:
| Q |
411 |
taaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4167521 |
taaaaattggcttaattgcacttttggacccctatct |
4167485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 18553292 - 18553256
Alignment:
| Q |
411 |
taaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18553292 |
taaaaaatggcttaattgcaattttggacccctatct |
18553256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Complemental strand, 6745314 - 6745279
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6745314 |
aaaaaaaggcttaattgcacttttggacccctatct |
6745279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 32332133 - 32332168
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32332133 |
aaaaaaaggcttaattgcacttttggacccctatct |
32332168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Complemental strand, 37205861 - 37205826
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37205861 |
aaaaaaaggcttaattgcacttttggacccctatct |
37205826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Complemental strand, 45209296 - 45209261
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45209296 |
aaaaaaaggcttaattgcacttttggacccctatct |
45209261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Complemental strand, 5734500 - 5734470
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5734500 |
atggcttaattgcacttttggacccctatct |
5734470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 418
Target Start/End: Original strand, 6839837 - 6839883
Alignment:
| Q |
372 |
ttttgagttcctcaaatgaggggaattttgtactatgaataaaaaat |
418 |
Q |
| |
|
||||| || |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
6839837 |
ttttgtgtccctcaaatgaggggaattttatattatgaataaaaaat |
6839883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Complemental strand, 7318950 - 7318920
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7318950 |
atggcttaattgcacttttggacccctatct |
7318920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Complemental strand, 39626283 - 39626253
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39626283 |
atggcttaattgcacttttggacccctatct |
39626253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Complemental strand, 39635833 - 39635803
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39635833 |
atggcttaattgcacttttggacccctatct |
39635803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 414666 - 414695
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
414666 |
tggcttaattgcacttttggacccctatct |
414695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 2321831 - 2321802
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2321831 |
tggcttaattgcacttttggacccctatct |
2321802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 4107162 - 4107133
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4107162 |
tggcttaattgcacttttggacccctatct |
4107133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 6641912 - 6641883
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6641912 |
tggcttaattgcacttttggacccctatct |
6641883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 7151156 - 7151127
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7151156 |
tggcttaattgcacttttggacccctatct |
7151127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 18531147 - 18531118
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18531147 |
tggcttaattgcacttttggacccctatct |
18531118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 20096001 - 20095972
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20096001 |
tggcttaattgcacttttggacccctatct |
20095972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 20283989 - 20283960
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20283989 |
tggcttaattgcacttttggacccctatct |
20283960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 20814055 - 20814026
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20814055 |
tggcttaattgcacttttggacccctatct |
20814026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 21070617 - 21070588
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21070617 |
tggcttaattgcacttttggacccctatct |
21070588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 23233780 - 23233809
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23233780 |
tggcttaattgcacttttggacccctatct |
23233809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 31190642 - 31190671
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31190642 |
tggcttaattgcacttttggacccctatct |
31190671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 39515557 - 39515586
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39515557 |
tggcttaattgcacttttggacccctatct |
39515586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 40918688 - 40918659
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40918688 |
tggcttaattgcacttttggacccctatct |
40918659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 414968 - 414940
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
414968 |
ggcttaattgcacttttggacccctatct |
414940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 1657698 - 1657670
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1657698 |
ggcttaattgcacttttggacccctatct |
1657670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 2321516 - 2321544
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2321516 |
ggcttaattgcacttttggacccctatct |
2321544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 6014419 - 6014447
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6014419 |
ggcttaattgcacttttggacccctatct |
6014447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 6107117 - 6107145
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6107117 |
ggcttaattgcacttttggacccctatct |
6107145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 6335641 - 6335613
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6335641 |
ggcttaattgcacttttggacccctatct |
6335613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 8870259 - 8870287
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8870259 |
ggcttaattgcacttttggacccctatct |
8870287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 14032036 - 14032064
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14032036 |
ggcttaattgcacttttggacccctatct |
14032064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 15187928 - 15187956
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15187928 |
ggcttaattgcacttttggacccctatct |
15187956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 17943358 - 17943386
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17943358 |
ggcttaattgcacttttggacccctatct |
17943386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 415 - 447
Target Start/End: Original strand, 20056407 - 20056439
Alignment:
| Q |
415 |
aaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
20056407 |
aaatggcttaattgcacttttggacccttatct |
20056439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 20095686 - 20095714
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20095686 |
ggcttaattgcacttttggacccctatct |
20095714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 23234093 - 23234065
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23234093 |
ggcttaattgcacttttggacccctatct |
23234065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 27339543 - 27339571
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27339543 |
ggcttaattgcacttttggacccctatct |
27339571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 27822875 - 27822903
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27822875 |
ggcttaattgcacttttggacccctatct |
27822903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 30359155 - 30359127
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30359155 |
ggcttaattgcacttttggacccctatct |
30359127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 30845873 - 30845845
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30845873 |
ggcttaattgcacttttggacccctatct |
30845845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 32318819 - 32318791
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32318819 |
ggcttaattgcacttttggacccctatct |
32318791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 36226728 - 36226700
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36226728 |
ggcttaattgcacttttggacccctatct |
36226700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 36801677 - 36801649
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36801677 |
ggcttaattgcacttttggacccctatct |
36801649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 37639507 - 37639535
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37639507 |
ggcttaattgcacttttggacccctatct |
37639535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 37953374 - 37953402
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37953374 |
ggcttaattgcacttttggacccctatct |
37953402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 38593187 - 38593215
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38593187 |
ggcttaattgcacttttggacccctatct |
38593215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 39616864 - 39616836
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39616864 |
ggcttaattgcacttttggacccctatct |
39616836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 42267456 - 42267484
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42267456 |
ggcttaattgcacttttggacccctatct |
42267484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 42267771 - 42267743
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42267771 |
ggcttaattgcacttttggacccctatct |
42267743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 42642401 - 42642373
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42642401 |
ggcttaattgcacttttggacccctatct |
42642373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 42866406 - 42866378
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42866406 |
ggcttaattgcacttttggacccctatct |
42866378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 42906687 - 42906659
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42906687 |
ggcttaattgcacttttggacccctatct |
42906659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 327 - 416
Target Start/End: Original strand, 43733128 - 43733219
Alignment:
| Q |
327 |
tcatataaaccctctaaaactcctaaaaaccttctcccactacaattttg--agttcctcaaatgaggggaattttgtactatgaataaaaa |
416 |
Q |
| |
|
||||||||| |||| |||||||| ||||||| || ||| ||||||||| | | |||||||||||| | |||||||| |||||||||||| |
|
|
| T |
43733128 |
tcatataaatcctccaaaactcccaaaaaccctcctccaatacaattttttaattccctcaaatgaggaggattttgtattatgaataaaaa |
43733219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 45106435 - 45106463
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45106435 |
ggcttaattgcacttttggacccctatct |
45106463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 7714 - 7749
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7714 |
aaaaaaaggcttaattgcacttttggacccctatct |
7749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 447
Target Start/End: Complemental strand, 238948 - 238909
Alignment:
| Q |
409 |
aataaaaaat-ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
238948 |
aataaaaaataggcttaattgcacttttggacccctatct |
238909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 238622 - 238650
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
238622 |
ggcttaattgcacttttggacccctatct |
238650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 70)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 447
Target Start/End: Original strand, 22202481 - 22202512
Alignment:
| Q |
416 |
aatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22202481 |
aatggcttaattgcacttttggacccctatct |
22202512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Complemental strand, 33576729 - 33576694
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33576729 |
aaaaaaaggcttaattgcacttttggacccctatct |
33576694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 447
Target Start/End: Original strand, 37181997 - 37182032
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37181997 |
aaaaaaaggcttaattgcacttttggacccctatct |
37182032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 447
Target Start/End: Original strand, 44895638 - 44895677
Alignment:
| Q |
409 |
aataaaaaat-ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44895638 |
aataaaaaataggcttaattgcacttttggacccctatct |
44895677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 445
Target Start/End: Original strand, 32507919 - 32507953
Alignment:
| Q |
411 |
taaaaaatggcttaattgcacttttggacccctat |
445 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32507919 |
taaaaaaaggcttaattgcacttttggacccctat |
32507953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 447
Target Start/End: Original strand, 53192108 - 53192142
Alignment:
| Q |
413 |
aaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53192108 |
aaaaaaggcttaattgcacttttggacccctatct |
53192142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 444
Target Start/End: Original strand, 54717160 - 54717190
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggaccccta |
444 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54717160 |
aaaatggcttaattgcacttttggaccccta |
54717190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 2119028 - 2118999
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2119028 |
tggcttaattgcacttttggacccctatct |
2118999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 3212466 - 3212437
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3212466 |
tggcttaattgcacttttggacccctatct |
3212437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 5577247 - 5577218
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5577247 |
tggcttaattgcacttttggacccctatct |
5577218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 17483560 - 17483589
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17483560 |
tggcttaattgcacttttggacccctatct |
17483589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 17483872 - 17483843
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17483872 |
tggcttaattgcacttttggacccctatct |
17483843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 20982279 - 20982308
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20982279 |
tggcttaattgcacttttggacccctatct |
20982308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 25053898 - 25053869
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25053898 |
tggcttaattgcacttttggacccctatct |
25053869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 27857449 - 27857420
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27857449 |
tggcttaattgcacttttggacccctatct |
27857420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 27984138 - 27984167
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27984138 |
tggcttaattgcacttttggacccctatct |
27984167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Complemental strand, 40082508 - 40082475
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
40082508 |
aaaaaggcttaattgcacttttggacccctatct |
40082475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 41282161 - 41282132
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41282161 |
tggcttaattgcacttttggacccctatct |
41282132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 44184285 - 44184256
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44184285 |
tggcttaattgcacttttggacccctatct |
44184256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 45760547 - 45760518
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45760547 |
tggcttaattgcacttttggacccctatct |
45760518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 47530338 - 47530367
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47530338 |
tggcttaattgcacttttggacccctatct |
47530367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 51213306 - 51213335
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51213306 |
tggcttaattgcacttttggacccctatct |
51213335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 53192427 - 53192398
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53192427 |
tggcttaattgcacttttggacccctatct |
53192398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 257749 - 257721
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
257749 |
ggcttaattgcacttttggacccctatct |
257721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 2239543 - 2239515
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2239543 |
ggcttaattgcacttttggacccctatct |
2239515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 2711701 - 2711729
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2711701 |
ggcttaattgcacttttggacccctatct |
2711729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 8313949 - 8313977
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8313949 |
ggcttaattgcacttttggacccctatct |
8313977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 9153477 - 9153505
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9153477 |
ggcttaattgcacttttggacccctatct |
9153505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 10864115 - 10864143
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10864115 |
ggcttaattgcacttttggacccctatct |
10864143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 10864432 - 10864404
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10864432 |
ggcttaattgcacttttggacccctatct |
10864404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 12881235 - 12881263
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12881235 |
ggcttaattgcacttttggacccctatct |
12881263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 12881528 - 12881500
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12881528 |
ggcttaattgcacttttggacccctatct |
12881500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 14904442 - 14904470
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14904442 |
ggcttaattgcacttttggacccctatct |
14904470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 17916396 - 17916368
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17916396 |
ggcttaattgcacttttggacccctatct |
17916368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 19391638 - 19391666
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19391638 |
ggcttaattgcacttttggacccctatct |
19391666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 19392016 - 19391988
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19392016 |
ggcttaattgcacttttggacccctatct |
19391988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 19914476 - 19914504
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19914476 |
ggcttaattgcacttttggacccctatct |
19914504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 19914785 - 19914757
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19914785 |
ggcttaattgcacttttggacccctatct |
19914757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 20982572 - 20982544
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20982572 |
ggcttaattgcacttttggacccctatct |
20982544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 21841727 - 21841755
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21841727 |
ggcttaattgcacttttggacccctatct |
21841755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 25126311 - 25126283
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25126311 |
ggcttaattgcacttttggacccctatct |
25126283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 26494685 - 26494713
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26494685 |
ggcttaattgcacttttggacccctatct |
26494713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 27748244 - 27748272
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27748244 |
ggcttaattgcacttttggacccctatct |
27748272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 27748556 - 27748528
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27748556 |
ggcttaattgcacttttggacccctatct |
27748528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 27766518 - 27766546
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27766518 |
ggcttaattgcacttttggacccctatct |
27766546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 27766830 - 27766802
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27766830 |
ggcttaattgcacttttggacccctatct |
27766802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 28097745 - 28097709
Alignment:
| Q |
411 |
taaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
28097745 |
taaaaaaaggcttaattccacttttggacccctatct |
28097709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 28964153 - 28964181
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28964153 |
ggcttaattgcacttttggacccctatct |
28964181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 28964467 - 28964439
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28964467 |
ggcttaattgcacttttggacccctatct |
28964439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 31117620 - 31117648
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31117620 |
ggcttaattgcacttttggacccctatct |
31117648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 415 - 447
Target Start/End: Complemental strand, 31869512 - 31869480
Alignment:
| Q |
415 |
aaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
31869512 |
aaatagcttaattgcacttttggacccctatct |
31869480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 32205160 - 32205132
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32205160 |
ggcttaattgcacttttggacccctatct |
32205132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 33621866 - 33621894
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33621866 |
ggcttaattgcacttttggacccctatct |
33621894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 38511970 - 38511942
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38511970 |
ggcttaattgcacttttggacccctatct |
38511942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 41223513 - 41223541
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41223513 |
ggcttaattgcacttttggacccctatct |
41223541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 41281845 - 41281873
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41281845 |
ggcttaattgcacttttggacccctatct |
41281873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 42230344 - 42230316
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42230344 |
ggcttaattgcacttttggacccctatct |
42230316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 42465691 - 42465719
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42465691 |
ggcttaattgcacttttggacccctatct |
42465719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 44177288 - 44177316
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44177288 |
ggcttaattgcacttttggacccctatct |
44177316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 44183972 - 44184000
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44183972 |
ggcttaattgcacttttggacccctatct |
44184000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 44624539 - 44624511
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44624539 |
ggcttaattgcacttttggacccctatct |
44624511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 44895961 - 44895933
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44895961 |
ggcttaattgcacttttggacccctatct |
44895933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 45743899 - 45743927
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45743899 |
ggcttaattgcacttttggacccctatct |
45743927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 47423441 - 47423413
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47423441 |
ggcttaattgcacttttggacccctatct |
47423413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 47530653 - 47530625
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47530653 |
ggcttaattgcacttttggacccctatct |
47530625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 47943773 - 47943745
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47943773 |
ggcttaattgcacttttggacccctatct |
47943745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 50033554 - 50033526
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50033554 |
ggcttaattgcacttttggacccctatct |
50033526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 52916859 - 52916887
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52916859 |
ggcttaattgcacttttggacccctatct |
52916887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 53531806 - 53531834
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53531806 |
ggcttaattgcacttttggacccctatct |
53531834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 53532119 - 53532091
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53532119 |
ggcttaattgcacttttggacccctatct |
53532091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 447
Target Start/End: Complemental strand, 16069 - 16039
Alignment:
| Q |
417 |
atggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16069 |
atggcttaattgcacttttggacccctatct |
16039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 447
Target Start/End: Complemental strand, 401025 - 400991
Alignment:
| Q |
413 |
aaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
401025 |
aaaaaaggcttaattgcacttttggacccctatct |
400991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 400704 - 400732
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
400704 |
ggcttaattgcacttttggacccctatct |
400732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 21361 - 21332
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21361 |
tggcttaattgcacttttggacccctatct |
21332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Original strand, 22294 - 22323
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22294 |
tggcttaattgcacttttggacccctatct |
22323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 447
Target Start/End: Complemental strand, 22590 - 22561
Alignment:
| Q |
418 |
tggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22590 |
tggcttaattgcacttttggacccctatct |
22561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 408 - 444
Target Start/End: Original strand, 26181 - 26218
Alignment:
| Q |
408 |
gaataaaaaat-ggcttaattgcacttttggaccccta |
444 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26181 |
gaataaaaaataggcttaattgcacttttggaccccta |
26218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 75103 - 75136
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggacccctat |
445 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
75103 |
aaaaaaaggcttaattgcacttttggacccctat |
75136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 30; Significance: 0.0000002; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 447
Target Start/End: Complemental strand, 12976 - 12943
Alignment:
| Q |
414 |
aaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
12976 |
aaaaaggcttaattgcacttttggacccctatct |
12943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 78990 - 79018
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
78990 |
ggcttaattgcacttttggacccctatct |
79018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 79300 - 79272
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
79300 |
ggcttaattgcacttttggacccctatct |
79272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 819 - 847
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
819 |
ggcttaattgcacttttggacccctatct |
847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 146 - 118
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
146 |
ggcttaattgcacttttggacccctatct |
118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 183 - 155
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
183 |
ggcttaattgcacttttggacccctatct |
155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 4834 - 4806
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4834 |
ggcttaattgcacttttggacccctatct |
4806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 6868 - 6896
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6868 |
ggcttaattgcacttttggacccctatct |
6896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 10941 - 10913
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10941 |
ggcttaattgcacttttggacccctatct |
10913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 16231 - 16203
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16231 |
ggcttaattgcacttttggacccctatct |
16203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 10559 - 10587
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10559 |
ggcttaattgcacttttggacccctatct |
10587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 412 - 444
Target Start/End: Original strand, 21831 - 21863
Alignment:
| Q |
412 |
aaaaaatggcttaattgcacttttggaccccta |
444 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
21831 |
aaaaaaaggcttaattgcacttttggaccccta |
21863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 20595 - 20623
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20595 |
ggcttaattgcacttttggacccctatct |
20623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Original strand, 29650 - 29678
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29650 |
ggcttaattgcacttttggacccctatct |
29678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 29964 - 29936
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29964 |
ggcttaattgcacttttggacccctatct |
29936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 20947 - 20911
Alignment:
| Q |
411 |
taaaaaatggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
20947 |
taaaaaaaggcttaattgcacttttggacccttatct |
20911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 447
Target Start/End: Complemental strand, 81615 - 81587
Alignment:
| Q |
419 |
ggcttaattgcacttttggacccctatct |
447 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
81615 |
ggcttaattgcacttttggacccctatct |
81587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University