View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_22 (Length: 432)
Name: NF3545_low_22
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 402; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 402; E-Value: 0
Query Start/End: Original strand, 1 - 414
Target Start/End: Complemental strand, 18004311 - 18003898
Alignment:
| Q |
1 |
tcatcattcctcaaaaaccagagataacatatcttccatcacaagttgttctgatcggacatgtttttccggcaacagtttcagttttaggcagccagag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18004311 |
tcatcattcctcaaaaaccagagataacatatcttccatcacaagttgttccgatcggacatgtttttccggcaacagtttcagttttaggcagccagag |
18004212 |
T |
 |
| Q |
101 |
cacatgtttctcggaaactctccaaacatggggggaggagcaccacaatgcagtggaggactcacatttggcggaacaaaacaacgtgcttctgttgttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18004211 |
cacatgtttctcggaaactctccaaacatggggggaggagcaccacaatgcagtggaggactcacatttggcggaacaaaacaacgtgcttctgttgtcc |
18004112 |
T |
 |
| Q |
201 |
ggtgatagtttcaccgaacaggcaaatcatccttggcttaatcacttcggtttcggtgttttcatggtaattggtcacttattttgtgcttttcatgtgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18004111 |
ggtgatagtttcaccgaacaggcaaatcatccttggcttaatcacttcggtttcggtgttttcatggtaattggtcacttattttgtgcttttcatgtgt |
18004012 |
T |
 |
| Q |
301 |
tcttgtgaattactctttttgagagaaacttcaaagtgtgtgcattagcacttggaacctttttattactttcacaagtattttaaagttggtattgctt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18004011 |
tcttgtgaattactctttttgagagaaacttcaaagtgtgtgcattagcacttggaacctttttattactttcacaagtattttaaaattggtattgctt |
18003912 |
T |
 |
| Q |
401 |
acacttgtcttttg |
414 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18003911 |
acacttgtcttttg |
18003898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University