View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_37 (Length: 331)
Name: NF3545_low_37
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 18 - 326
Target Start/End: Original strand, 34841987 - 34842295
Alignment:
| Q |
18 |
tatactccctcaaagtgaatttcttatatacagctggcttgttttcactttgtataactgcatcattgaagggacaatagaaaaatgctgtagaaaacct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34841987 |
tatactccctcaaagtgaatttcttatatacagctggcttgttttcactttgtataactgcatcattgaagggacaatagaaaaatgctgtagaaaacct |
34842086 |
T |
|
| Q |
118 |
ctctacctcttcagcagcaaccactctgtgttttatgcttttgtaaacatcattgcttaatgcctgcaaggacacatatattggagtaattaaagggtcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34842087 |
ctctacctcttcagcagcaaccactctgtgttttatgcttttgtaaacatcattgcttaatgcctgcaaggacacatatattggagtaattaaaggttcc |
34842186 |
T |
|
| Q |
218 |
atatttcgtcaacctataagacaaaaaatattgagaatatttttacttactgtagtaattaactaatgtcatactcctgatgattaacttttttatatga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34842187 |
atatttcgtcaacctataagacaaaaaatattgagaatatttttacttactgtagtaattaactaatgtcatactcctgatgattaacttttttatatta |
34842286 |
T |
|
| Q |
318 |
tgatgtcca |
326 |
Q |
| |
|
||||||||| |
|
|
| T |
34842287 |
tgatgtcca |
34842295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University