View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_45 (Length: 295)
Name: NF3545_low_45
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_45 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 236
Target Start/End: Complemental strand, 31850014 - 31849800
Alignment:
| Q |
20 |
tcgattatatactcctcctatctaaggtataccttcacatgaccttcatctcgtatgtttccatttttggcaaatgacgtgaaatccattgaatcaatta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31850014 |
tcgattatatactcctcctatctaaggtataccttcacatgaccttcatc--gtatgtttccatttttggcaaatgacgtgaaatccattgaatcaatta |
31849917 |
T |
|
| Q |
120 |
acttctgatgacatgtgatatgatagtgtatgtgattgtaatctcatttggatgtcttgcaactagaatccataaatgcttctttccatgtcccttacat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31849916 |
acttctgatgacatgtgatatgatagtgtatgtgattgtaatctcatttggatgtcttgcaactagaatccataaatgcttctttccatgtcccttacat |
31849817 |
T |
|
| Q |
220 |
agaaagtctaagtataa |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31849816 |
agaaagtctaagtataa |
31849800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 243 - 281
Target Start/End: Complemental strand, 31849747 - 31849709
Alignment:
| Q |
243 |
agaacggaaatagaaacatcgatataatgaaatgctccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31849747 |
agaacggaaatagaaacatcgatataatgaaatactccc |
31849709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University