View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_50 (Length: 265)
Name: NF3545_low_50
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 36440030 - 36439787
Alignment:
| Q |
1 |
ttttcaagggcagtctacatcaacaattatatggatgattatattcatcaaaatgggtacattattcggaactcaatgaacccaaacaccaagaactctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36440030 |
ttttcaagggcagtctacatcaacaattatatggatgattatattcatcaa--tgggtacattattcggaactcaatgaacccaaacaccaagaactctt |
36439933 |
T |
 |
| Q |
101 |
acttcgcgaagtttggccacactagacttagggccaatgctacatcaagagtgaaattagcaaaatgtcttatcaccaaagatgaggctactaattcact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
36439932 |
acttcgcgaagtttggccacactagacttagggccaatgctacatcaagagtgaaatgagcaaaatgtcttatcaccaaagatg--------aattcact |
36439841 |
T |
 |
| Q |
201 |
attcaattattgcttcagggtagcacttggttgccttctattaacattccctatg |
255 |
Q |
| |
|
||| |||||| || |||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
36439840 |
attgaattatggcctcagggtagcactt-gttgccttctattaacattccttatg |
36439787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University