View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_51 (Length: 264)
Name: NF3545_low_51
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 256
Target Start/End: Complemental strand, 25612389 - 25612147
Alignment:
| Q |
14 |
tttcataagtgtggttcattgttgaacttggagttaaagtgcgcgcaaatgatgaatgcagtggaagaagggttgcatatgttcaatgataggggtgatc |
113 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| || |||||||| | |||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25612389 |
tttcaaaagtgtggttcattgttcaacttggattttaagtgcgcacgaatgatgaatacagtggaagaagggttgcatatgttcaatgataggagtgatc |
25612290 |
T |
 |
| Q |
114 |
ttaaaattttctactggtttatttcgtagagtttgtcaattctagtgtcctatcagtgggtgtgggtgggatttgcttatgtagctatgtagtacacttt |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25612289 |
ttaaaattttctactggtttatttgatagagtttgtcaattctagtgtcctatcagtgggtgtgggtgggatttgcttatgtagctatgtagtacacttt |
25612190 |
T |
 |
| Q |
214 |
gatatatcatttactgtatattaatattaacatatcctatgct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25612189 |
gatatatcatttactgtatattaatattaacatatcctctgct |
25612147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 25615835 - 25616089
Alignment:
| Q |
1 |
ctgggtatgactgtttcataagtgtggttcattgttgaacttggagttaaagtgcgcgcaaatgatgaatgcagtggaagaagggttgcatatgttcaat |
100 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||| |
|
|
| T |
25615835 |
ctgggtatgactgtttcaaaagtatggttcattgttgaacttggagttaaagtgcgcgcaaatgatgaatgcagtggaagaagggtggcatatgcttaat |
25615934 |
T |
 |
| Q |
101 |
gataggggtgatcttaaaattttctactggtttatttcgtagagtttgtcaattctagtgtcctatcagtgggtgtgggtgggatttgcttatgtagcta |
200 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| ||||||| | |||||||||||||||||| |||||||||| ||||||||||||||||| || |
|
|
| T |
25615935 |
gataggagtgatcttaaaatattctactggtttatttcatagagttcgacaattctagtgtcctatcggtgggtgtggatgggatttgcttatgtaatta |
25616034 |
T |
 |
| Q |
201 |
tgtagtacactttgatatatcatttactgtatattaatattaacatatcctatgctt |
257 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||| |||| |||||| ||||| |
|
|
| T |
25616035 |
tgcagtacactttgatatatcatttac--tatattaatagtaacgtatcctgtgctt |
25616089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University