View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_52 (Length: 261)
Name: NF3545_low_52
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 28 - 245
Target Start/End: Original strand, 52248249 - 52248464
Alignment:
| Q |
28 |
gataaaattgctagcttttctctctaggtcaatatatattgtgacatgtattctcaggacgtgaccatttaagcatactaatatatatggagtagtatgt |
127 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52248249 |
gataaaatggctagcttttctctctaggtcaatatatattgtgacatgtattctcaggacgtgaccatttaagcatactaatatatatggagtagtatgt |
52248348 |
T |
 |
| Q |
128 |
gttacgaacttcacatgtcatgacttattataacgggacactttgtgtactacactactttgcccagtgaaatcaaaattgccgtataattatgtactat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
52248349 |
gttacgaacttcacatgtcatgacttattataacgggacactttgtgtactacactactttgcccagtgaaatcaaaattgccgtatacttatgtac--t |
52248446 |
T |
 |
| Q |
228 |
tttgttcacaagggtaaa |
245 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52248447 |
tttgttcacaagggtaaa |
52248464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 41282050 - 41282084
Alignment:
| Q |
1 |
aaagggtgttcatgtaacatttttcaagataaaat |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41282050 |
aaagggtgttcatgtaacatttttcaagaaaaaat |
41282084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University