View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_58 (Length: 251)
Name: NF3545_low_58
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 26461150 - 26460939
Alignment:
| Q |
19 |
agttatgtcatgagagccaatcctggttattatgtgtcactcatcatgccattgcctcaagaacaagaaggagagaatagtagtaataatgaggtgaaga |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26461150 |
agttatgtcatgagagcaaatcctggttattatgtgtcactcatcatgccattgcctcaagaacaagaaggagagaatagta---ataatgaggtgaaga |
26461054 |
T |
 |
| Q |
119 |
agcctgtgcttttcactcgtgttaagttgcttaagcctgatgacactctcactttaggacatgcttataggctcatcacaactcaaggtagtttctttgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26461053 |
agcctgtgcttttcactcgtgttaagttgcttaagcctgatgacactctcactttaggacatgcttataggctcatcacaactcaaggtagtttctttgt |
26460954 |
T |
 |
| Q |
219 |
tttcaatggtctgtg |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26460953 |
tttcaatggtctgtg |
26460939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 208
Target Start/End: Complemental strand, 15406954 - 15406879
Alignment:
| Q |
133 |
actcgtgttaagttgcttaagcctgatgacactctcactttaggacatgcttataggctcatcacaactcaaggta |
208 |
Q |
| |
|
||||||||||||||||||| |||| |||| ||||| | | | || |||||||||||||||||||| | |||||||| |
|
|
| T |
15406954 |
actcgtgttaagttgcttaggcctaatgaaactcttaatcttggtcatgcttataggctcatcactaatcaaggta |
15406879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University