View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_61 (Length: 247)
Name: NF3545_low_61
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_61 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 25615572 - 25615801
Alignment:
| Q |
18 |
ctccaaaacacgatcccaactaaagataatttgatatgaagaagcatcatcaatacaagttagaagctgtgggatggaggaaacagaacaacatttatta |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25615572 |
ctccaaaacacgatcccaactaaggataatttgatatgaagaagcatcatcaatacaagttagaagctgtgggatggaggaaatagaacaacatttatta |
25615671 |
T |
 |
| Q |
118 |
ttcgattgtccaatgttttcttttttgtgggtggaaattttgagatggctcgaggacttctatggtagtgcgttctggtttaagttagcacagcagttgc |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25615672 |
ttcgattgtccaatgttttctttgttgtgggtggaaattttgagatggctcgaggacttctatggtagtgcgtactggtttaagttagcacagcagttgc |
25615771 |
T |
 |
| Q |
218 |
tgtttttcatataaatgttgccgcaggatt |
247 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
25615772 |
tgcttttcatataaatgttgccgcaggatt |
25615801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University