View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_74 (Length: 238)
Name: NF3545_low_74
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 52 - 222
Target Start/End: Original strand, 4176240 - 4176417
Alignment:
| Q |
52 |
ttcaattcatcgactatgatgagtcatttgagtaggaagggttgcatgtgtaaattaaattcactaaattgtgtatgacttcacttgcttgttagtttat |
151 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4176240 |
ttcaattcatcgactgtgatgagtcatttgagtaggaggggttgcatgtgtaaattaaattcactaaattgtgtatgacttcacttgcttgttattttat |
4176339 |
T |
 |
| Q |
152 |
gatttttcaaca-------nnnnnnnnnatgtaaaacttgtatgcaacattttgtgatttttaatcatatattttact |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4176340 |
gatttttcaacattttttttttttttttatgtaaaacttgtatgcaacattttgtgatttttaatcatatattttact |
4176417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University