View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_78 (Length: 236)
Name: NF3545_low_78
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_78 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 484 - 260
Alignment:
| Q |
1 |
ttacatcaccacattcaatgttcctaactagctgcatgaataaaacaggttgcttttatcataaccaatggtttccatttccctatactaattactaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
484 |
ttacatcaccacattcaatgttcctaactagctgcatgaataaaacagtttgcttttatcataaccaatggtttccatttccctatactaattactactt |
385 |
T |
 |
| Q |
101 |
cttgacaacaccgtttggtttgtagtca---ttatgtcaaagtagcttaatccaaactccaaaacttgtttctgtttccaccttttggtcactcaagatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384 |
cttgacaacaccgtttggtttgtagtcattattatgtcaaagtagcttaatccaaactccaaaacttgtttctgtttccaccttttggtcactcaagatg |
285 |
T |
 |
| Q |
198 |
aggtctgaaaatatgggatcattgt |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
284 |
aggtctgaaaatatgggatcattgt |
260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University