View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3545_low_88 (Length: 211)
Name: NF3545_low_88
Description: NF3545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3545_low_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 18 - 132
Target Start/End: Complemental strand, 37652623 - 37652509
Alignment:
| Q |
18 |
gtgttgatagagagacaaaggagactgtctcaatccatggaaaacttagatacaacaacaccatacaacggtgaattatctccttagagacatccaagtc |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37652623 |
gtgttgatagagagacaaaggagattgtctcaatccatggaaaacttagatacaacaacaccatgcaacggtgaattatctccttagagacatccaagtc |
37652524 |
T |
 |
| Q |
118 |
gggatccatcattca |
132 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37652523 |
tggatccatcattca |
37652509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University