View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_high_57 (Length: 259)
Name: NF3546_high_57
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_high_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 9 - 254
Target Start/End: Original strand, 5510444 - 5510689
Alignment:
| Q |
9 |
caagtagttgtagtttcggcttgtgttttgaataatatctagaaatcctggaccttggtttgtcatatcacaaaattgtggttttcctttctgttactta |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5510444 |
caagcagttgtagtttcggcttgtgttttgaataatatctagaaatcctggaccttggtttgtaatatcactaaattgtggttttcctttctgttactta |
5510543 |
T |
 |
| Q |
109 |
attggattatggcttttctatttagtttttctgttccatgaattctagttctgttactttatagtccagtcatgaagttgtattttgttctatattatct |
208 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||| | |||| ||||||||||||| ||| ||||| |||||| ||| |||||||||| | |
|
|
| T |
5510544 |
attggattctggtttttctatttagtttttctgttccatgaatttttgttcatttactttatagtctagtaatgaaattgtatcttgctctatattattt |
5510643 |
T |
 |
| Q |
209 |
actgcaaacttaggcttgccctgcttcattgatagatatccatttc |
254 |
Q |
| |
|
||||| |||||| ||| |||| || ||| |||||||||||||||| |
|
|
| T |
5510644 |
actgccaacttaatcttcccctactacatagatagatatccatttc |
5510689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 29 - 78
Target Start/End: Complemental strand, 1188907 - 1188858
Alignment:
| Q |
29 |
ttgtgttttgaataatatctagaaatcctggaccttggtttgtcatatca |
78 |
Q |
| |
|
|||||||||||| |||| ||||||||| || |||||||||||| |||||| |
|
|
| T |
1188907 |
ttgtgttttgaacaatagctagaaatcttgaaccttggtttgtaatatca |
1188858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University