View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_high_61 (Length: 250)
Name: NF3546_high_61
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_high_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 11 - 104
Target Start/End: Complemental strand, 5174754 - 5174657
Alignment:
| Q |
11 |
cagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatg----catgagttagataaatgttcattttacatatg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
5174754 |
cagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatgcatgcatgagttagataaatgttcattttaaatatg |
5174657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 194 - 240
Target Start/End: Complemental strand, 5174650 - 5174604
Alignment:
| Q |
194 |
tattattgtctacttgctccaattattaacagcaacatatcttatct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174650 |
tattattgtctacttgctccaattattaacagcaacatatcttatct |
5174604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University