View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_high_65 (Length: 249)
Name: NF3546_high_65
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_high_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 3 - 237
Target Start/End: Complemental strand, 32752657 - 32752423
Alignment:
| Q |
3 |
tgcttttgttgttggtttcgcagagtacaggagctcgtagctgcctctcaaatgtaggttgctaaactcgatcatttgtaggggaaggaggattagaacg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32752657 |
tgcttttgttgttggtttcgcagagtacaggagctcgtagctacaactcaaatgtaggttgctaaactcgatcatttgtaggggaaggaggattagaacg |
32752558 |
T |
|
| Q |
103 |
taaaggctcattagcaatactcaaaagcaaatcatgcatgtcttccaattctgacgatagaactggaacttgtacttctagcgcattctttttagaatct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
32752557 |
taaaggctcattagcaatactcaaaagcaaatcatgcatgtcttccaattctgacgatagaactggaacttgtacttctaccacattctttttagaatct |
32752458 |
T |
|
| Q |
203 |
tccatatccataaccactgcattcctatcactcct |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
32752457 |
tccatatccataaccactgcatccctatcactcct |
32752423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 76 - 237
Target Start/End: Complemental strand, 3030835 - 3030671
Alignment:
| Q |
76 |
atttgtaggggaaggaggattagaacgtaaaggctcattagcaatactcaaaagcaaatcatg---catgtcttccaattctgacgatagaactggaact |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
3030835 |
atttgtaggggaaggaggattagaacgtaaaggctcattagcaatactcaaaagcaaattatgatgcatgtcttcaaattctgacgatagaactggaact |
3030736 |
T |
|
| Q |
173 |
tgtacttctagcgcattctttttagaatcttccatatccataaccactgcattcctatcactcct |
237 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||| |||| |||| |||| |||||||||||| |
|
|
| T |
3030735 |
tgtacttctagcacattctttttagaattttccatattcatatccacagcatccctatcactcct |
3030671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 76 - 220
Target Start/End: Complemental strand, 3021615 - 3021474
Alignment:
| Q |
76 |
atttgtaggggaaggaggattagaacgtaaaggctcattagcaatactcaaaagcaaatcatgcatgtcttccaattctgacgatagaactggaacttgt |
175 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| |||||||| | |||||||| |||||||||||| |||||||| || | |||||||| ||| |
|
|
| T |
3021615 |
atttgttggggaaggaggagctgaacgtaaaggctcattggcaatacttagaagcaaatgatgcatgtcttcaaattctgatgacaccactggaacctgt |
3021516 |
T |
|
| Q |
176 |
acttctagcgcattctttttagaatcttccatatccataaccact |
220 |
Q |
| |
|
|||||||| |||| || ||||||||||| ||||||| |||| |
|
|
| T |
3021515 |
gcttctagcatattc---ttggaatcttccatgtccataaacact |
3021474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 76 - 220
Target Start/End: Complemental strand, 3038484 - 3038343
Alignment:
| Q |
76 |
atttgtaggggaaggaggattagaacgtaaaggctcattagcaatactcaaaagcaaatcatgcatgtcttccaattctgacgatagaactggaacttgt |
175 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| |||||||| | |||||||| |||||||||||| |||||||| || | |||||||| ||| |
|
|
| T |
3038484 |
atttgttggggaaggaggagctgaacgtaaaggctcattggcaatacttagaagcaaatgatgcatgtcttcaaattctgatgacaccactggaacctgt |
3038385 |
T |
|
| Q |
176 |
acttctagcgcattctttttagaatcttccatatccataaccact |
220 |
Q |
| |
|
|||||||| |||| || ||||||||||| ||||||| |||| |
|
|
| T |
3038384 |
gcttctagcatattc---ttggaatcttccatgtccataaacact |
3038343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University