View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_high_68 (Length: 243)
Name: NF3546_high_68
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 31710980 - 31710750
Alignment:
| Q |
1 |
atcaacttcaatctcccaaatatggaatgaagttttatgactatgttgggaaggggtgacacaagctagatagattctgaattattgagttgtattgtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31710980 |
atcaacttcaatctcccaaatatggaatgaagttttatgactatgttgggaaggggtgacacaagctagatagattctgaattattgagttgtattgtag |
31710881 |
T |
|
| Q |
101 |
cttctttgattgatttggtcttttgtatttgtatcttttattgctacttgctagtgttacgtagtgctagctagtctcttattgcatggtccaattcaac |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31710880 |
ctcctttgattgatttggtcttttgtatttgtatcttttatt-------gctagtgttacgtagtgctagctagtctcttattgcatggtccaattcaac |
31710788 |
T |
|
| Q |
201 |
tagatgctaataaaaacaacattgattttgatgatgtc |
238 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31710787 |
tatatgctaataaaaacaacattgattttgatgatgtc |
31710750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University