View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_high_72 (Length: 240)
Name: NF3546_high_72
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_high_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 44056651 - 44056430
Alignment:
| Q |
1 |
ctttgttctcaagccctttcgccagccgcgcgtcatagcagaaattctggttagttgttttcttttcaaacacnnnnnnnctgtgatcatctcataatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44056651 |
ctttgttctcaagccctttcgccagccgcgcgtcatagcagaaattctggttagttgttttcttttcaaacacaaaaaaactgtgatcatctcataatgc |
44056552 |
T |
 |
| Q |
101 |
tgatagatgtgacgtgacattatcttcggtgcagggaggagtaatgttaggtccttcagtgctaggaaaaaacgaaatatttgccaatgcagttttccct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44056551 |
tgatagatgtgacgtgacattatcttcggtgcagggaggagtaatattaggtccttcagtgctaggaaaaaacgaaatatttgccaatgcagttttccct |
44056452 |
T |
 |
| Q |
201 |
ctaagaagtgtgatggtgattg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44056451 |
ctaagaagtgtgatggtgattg |
44056430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 222
Target Start/End: Complemental strand, 39238351 - 39238299
Alignment:
| Q |
170 |
aaacgaaatatttgccaatgcagttttccctctaagaagtgtgatggtgattg |
222 |
Q |
| |
|
|||| ||| |||||| |||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
39238351 |
aaacaaaacatttgcagatgctgtttttcctctaagaagtgtgatggtgattg |
39238299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University