View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_high_78 (Length: 216)
Name: NF3546_high_78
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_high_78 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 34039882 - 34040070
Alignment:
| Q |
15 |
aggatcttgatcaccaacgtagaaccaatctgattcaccagaaccaccaagaatctgaaagcaaggatagaaataacccgaaatcggcatttgagaatgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34039882 |
aggatcttgatcaccaacgtagaaccaatcagattcaccagaaccaccaagaatctgaaagcaaggatagaaataacccgaaatcggcatttgagaatgc |
34039981 |
T |
|
| Q |
115 |
gatctcggcacgaattcaggcgcttgaacattgaatttgaagcttaaattgcttgtttcttgaacatgatctttttcttgattcatctc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
34039982 |
gatctcggcacgaattcaggcgcttgaacattgaatttgaagcttgaattgcttgtctcttgaacatgatctttttcttgattcttctc |
34040070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University