View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_high_83 (Length: 207)
Name: NF3546_high_83
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_high_83 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 8 - 192
Target Start/End: Original strand, 10416549 - 10416733
Alignment:
| Q |
8 |
gaggagcacagaggtttagcttggtgtcacatgagtcaccttgtgaactacttccatctccttgtgaagaagaacttccattcacttgtgaacttccaag |
107 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10416549 |
gaggaacactgaggtttagcttggtgtcacatgagtcaccttgtgaactacttccatctccttgtgaagaagaacttccattcacttgtgaacttccaag |
10416648 |
T |
 |
| Q |
108 |
gtttgctgaagcaacaaaacaaattgtgaaaatgagggatgctaagtatgccttcatttctgtatttcaattaattatgtttgtg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10416649 |
gtttgctgaagcaacaaaacaaattgtgaaaatgagggatgctaagtatgccttcatttctgtatttcaattaattatgtttgtg |
10416733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University