View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_low_30 (Length: 382)
Name: NF3546_low_30
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 12 - 379
Target Start/End: Complemental strand, 8467902 - 8467535
Alignment:
| Q |
12 |
aacctgtgaaggaaatgaaaccaaaagcttccaaacaaaccaaaacagcttctcatcctccatattttgaggtaattgtttcaaactttcaatatagttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467902 |
aacctgtgaaggaaatgaaaccaaaagcttccaaacaaaccaaaacagcttctcatcctccatattttgaggtaattgtttcaaactttcaatatagttt |
8467803 |
T |
 |
| Q |
112 |
caaactactggttgatttaagcgtatacttatttatttttgtagatggttaaggaggctttactggctctaaaggagaggaatggctcaagcccttacgc |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467802 |
caaacttctggttgatttaagcgtatacttatttatttttgtagatggttaaggaggctttactggctctaaaggagaggaatggctcaagcccttacgc |
8467703 |
T |
 |
| Q |
212 |
tatagcgaaatacatggacgagaagttcaagccggtgctcccagcaaatttcaagaagatactaagcttgcagcttaagaatcaaaccaagagagggaag |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467702 |
tatagcgaaatacatggacgagaagttcaagccggtgctcccagcaaatttcaagaagatactaagcttgcagcttaagaatcaaaccaagagagggaag |
8467603 |
T |
 |
| Q |
312 |
ctggtgaagatcaaagcttcgtataaactatctgatgccgagaagccgaagaaggagaaaaaagactc |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467602 |
ctggtgaagatcaaagcttcgtataaactatctgatgccgagaagccgaagaaggagaaaaaagactc |
8467535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University