View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_low_50 (Length: 274)
Name: NF3546_low_50
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_low_50 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 8135235 - 8135507
Alignment:
| Q |
1 |
tagtatcgtgtaccgcgtgatgaagaattcacaatcttctgcagttcatctttcttgtctaatatcattgatttgattagatatagtaagtcctgactta |
100 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8135235 |
tagtatcgtgtaccgcgtgatgaatatttcacaatcttctgcagttcatctttcttgtctaatatcattgatt-gattagatatagtaagtcctgactta |
8135333 |
T |
|
| Q |
101 |
ttgataaaacatgcatgtgagtgctgtaggcctagtgtgccaattgcaacagggtgatttttataatgttggaatgtgatgattttgtttgtatgggaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135334 |
ttgataaaacatgcatgtgagtgctgtaggcctagtgtgccaattgcaacagggtgatttttataatgttggaatgtgatgattttgtttgtatgggaag |
8135433 |
T |
|
| Q |
201 |
atatctatcatctaatgattgtaattatagacctacatgctcctctgtctgtagctgcattgcatgctccagtt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135434 |
atatctatcatctaatgattgtaattatagacctacatgctcctctgtctgtagctgcattgcatgctccagtt |
8135507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University