View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_low_54 (Length: 267)
Name: NF3546_low_54
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 259
Target Start/End: Original strand, 32417625 - 32417864
Alignment:
| Q |
20 |
aaaactatgaaaagaattagagcttgccttactcgaatttcgccgcgaaacaggagaatcattcggagtagtgattgtttttgctttctcagtttcaaga |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32417625 |
aaaattatgaaaagaattagagcttgccttactcgaatttcgccgcgaaacaggagaatcattcggagtagtgattgtttttgctttctcagtttcaaga |
32417724 |
T |
|
| Q |
120 |
tcattcatcatgttgattatgctcctaactccttcataacatgccccacatatcgtattccttggaggccttaatattaatggcatagttgtgcacacac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32417725 |
ccattcatcatgttgattatgctcctaactccttcataacatgccccacatattgtattccttggaggccttaatattaatggcatagttgtgcacacac |
32417824 |
T |
|
| Q |
220 |
aacaatccatttttgcttcttagaatttctctcctatgct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32417825 |
aacaatccatttttgcttcttagaatttctctcctatgct |
32417864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University