View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3546_low_61 (Length: 250)

Name: NF3546_low_61
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3546_low_61
NF3546_low_61
[»] chr2 (2 HSPs)
chr2 (11-104)||(5174657-5174754)
chr2 (194-240)||(5174604-5174650)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 11 - 104
Target Start/End: Complemental strand, 5174754 - 5174657
Alignment:
11 cagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatg----catgagttagataaatgttcattttacatatg 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||| |||||    
5174754 cagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatgcatgcatgagttagataaatgttcattttaaatatg 5174657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 194 - 240
Target Start/End: Complemental strand, 5174650 - 5174604
Alignment:
194 tattattgtctacttgctccaattattaacagcaacatatcttatct 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
5174650 tattattgtctacttgctccaattattaacagcaacatatcttatct 5174604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University