View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_low_62 (Length: 250)
Name: NF3546_low_62
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 27404077 - 27404000
Alignment:
| Q |
1 |
cacacaaacaatacacattggatagagatcattttaacaatatcacataactagaagtgatttagtaactaccatttttg |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
27404077 |
cacacaaacaatacacattggatagagatcattttaaca--atcacattactagaagtgatttagtaactagcatttttg |
27404000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 185 - 224
Target Start/End: Complemental strand, 45989514 - 45989475
Alignment:
| Q |
185 |
tagagaatgaccaacaaaatgaaccttaagatcacttcca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45989514 |
tagagaatgaccaacaaaatgaaccttaagatcacttcca |
45989475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University