View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_low_66 (Length: 246)
Name: NF3546_low_66
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_low_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 10 - 228
Target Start/End: Original strand, 36737053 - 36737271
Alignment:
| Q |
10 |
gcatagggctagaagcttagttgtgttgccaagagaaactagttcacgtaggggttatcgaaccggtggtggtgagggaagtagtagagggaagtctgta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36737053 |
gcatagggctagaagcttagttgtgttgccaagagaaactagttcacgtaggggttatcgaaccggtggtggtgagggaagtagtagagggaagtctgta |
36737152 |
T |
 |
| Q |
110 |
aggcggttggaccggggtttattatcagaccggtggctttttacaatggcgccacctttccttgtaagagcctcgtcgatgaggtcaccaagggtggcta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36737153 |
aggcggttggaccggggtttattatcagaccggtgggtttttacaatggcgccacctttccttgtaagagcctcgtcgatgaggtcaccaagggtggcta |
36737252 |
T |
 |
| Q |
210 |
gtagcgccggtgaaggtac |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36737253 |
gtagcgccggtgaaggtac |
36737271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University