View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3546_low_75 (Length: 227)

Name: NF3546_low_75
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3546_low_75
NF3546_low_75
[»] chr8 (1 HSPs)
chr8 (19-213)||(43862252-43862446)


Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 43862252 - 43862446
Alignment:
19 gattgtacttttgcagtttgatgaaactagcttgctgttcaggcatgcatgcagagattgaccagcctttaatccacatgcagctgcttacaagatttta 118  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43862252 gattgtacttttgcagtttgatgaaactagctagctgttcaggcatgcatgcagagattgaccagcctttaatccacatgcagctgcttacaagatttta 43862351  T
119 atttgtttggcatgttagattagttatctatgataacaaaattttatggaattataactttgtttaactttttcatggtcttcgagaaattttag 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43862352 atttgtttggcatgttagattagttatctatgataacaaaattttatggaattataactttgtttaactttttcatggtcttcgagaaattttag 43862446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University