View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_low_76 (Length: 224)
Name: NF3546_low_76
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 79 - 206
Target Start/End: Original strand, 36291874 - 36292001
Alignment:
| Q |
79 |
gagtgaaactcagtgatgggagacatttggcctaccgggagttcggctttccaaaggaagaagctaggtacaagatcattgtcgttcacggatatgccaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
36291874 |
gagtgaaactcagtgatgggagacatttggcctaccgggagtttggcttttcaaaagaagaagctaggtacaagatcattgtcattcatggatatgccaa |
36291973 |
T |
 |
| Q |
179 |
ttctaaagatacacatttaccagtttct |
206 |
Q |
| |
|
||||||||||||||| || || |||||| |
|
|
| T |
36291974 |
ttctaaagatacacacttgcctgtttct |
36292001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 36291791 - 36291853
Alignment:
| Q |
17 |
catagggtgggcttatatggtcttaaagccgcctccaccaaaaatatgtggatccgttaatgg |
79 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
36291791 |
catagggtgggtttatatggccttaaagccgcctccaccaaaaacatgcggatccattaatgg |
36291853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University