View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_low_81 (Length: 211)
Name: NF3546_low_81
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 41342030 - 41342217
Alignment:
| Q |
12 |
aagaatatggttggcttattgtagaagatttgttatgtatgttgtcgtcgtcgtccaatgcagtttgtcatgagtctgtctctaccggagggggtggtat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342030 |
aagaatatggttggcttattgtagaagatttgttatgtatgttgtcgtcgtcgtccaatgcagtttgtcatgagtctgtctctaccggagggggtggtat |
41342129 |
T |
 |
| Q |
112 |
accttcatacactctaactttcaagttcgtgagattttagtgagatacctgatccaacattgttcataagtatttataggaaataagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41342130 |
accttcatacactctaactttcaagttcgtgagattttagtgagatacctgacccaacgttgttcataagtatttataggaaataagt |
41342217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University