View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3546_low_82 (Length: 209)
Name: NF3546_low_82
Description: NF3546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3546_low_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 8229423 - 8229613
Alignment:
| Q |
1 |
aaggatatgcaataaatcaatctccacgtctttttatgatttccacattattcaacttgatggacacgttacaactagccaactgtacctattatatggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8229423 |
aaggatatgcaataaatcaatctccacgtctttttatgatttccacattattcaacttgatggacacgttacaactagccaactgtacctattatatggc |
8229522 |
T |
|
| Q |
101 |
taacgacttgcaactaattgcaccaaccatctttatgatcagaagattagtcaaaacaaactttattatgatcagaaaaggtgaactcatt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
8229523 |
taacgacttgcaactaattgcaccaaccatctttatgatcagaagattagtcaaaacaaactttattatgatcggaaaaggtgaattcatt |
8229613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University