View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_15 (Length: 481)
Name: NF3547_high_15
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 283 - 465
Target Start/End: Complemental strand, 20967014 - 20966832
Alignment:
| Q |
283 |
aacttagctcagttggtactgacaatgtaagatccgaggttcaagcctcgaccagcacgaaaacaagaaaagtataacgcgaagaggacnnnnnnnnnng |
382 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||| | |
|
|
| T |
20967014 |
aacttagctcagttgatggtgacaatgtaagatccgaggttcaagccccgaccaccaccaaaacaagaaaagtataacgcgaagaggacacaaaagaaag |
20966915 |
T |
 |
| Q |
383 |
taataaataatataattgtggctcaccagatgattaagagtgtattcttaatccaagtcattgatttgtatctcacgtctatt |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20966914 |
taataaataatataattgtggctcaccagatgattaagagtgtattcttaatccaagtcattgatttgtatctcacgtctatt |
20966832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University