View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_20 (Length: 460)
Name: NF3547_high_20
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 425; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 425; E-Value: 0
Query Start/End: Original strand, 1 - 441
Target Start/End: Complemental strand, 34861818 - 34861378
Alignment:
| Q |
1 |
tcagagtcacttgatcagtggaggagttactttcgttcatcgaattcggatattttcgatataattgaccatgcaattgttgttgctgcttctgattgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34861818 |
tcagagtcacttgatcagtggaggagttactttcgttcatcgaattcggatattttcgatataattgaccatgcaattgttgttgctgcttctgattgtc |
34861719 |
T |
 |
| Q |
101 |
caaaggagtttaagtcaaggagagatggaattgctgagagattgttttctgttatgctgaatcgttgtaaggggtgtgagaaagttgaattgtctgtgcc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34861718 |
caaaggagtttaagtctaggagagatggaattgctgagagattgttttctgttatgctgaatcgttgtaaggggtgtgagaaggttgaattgtctgtgcc |
34861619 |
T |
 |
| Q |
201 |
cgatgatgatgatggtgatgaactttgcaagagaagttctgttagagagggtgctagcaaagagagcaaggtggattgcagtagggaagaaaatggagtg |
300 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34861618 |
tgatgatgataatggtgatgaactttgcaagagaagttctgttagagagggtgctagcaaagagagcaaggtggattgcagtagggaagaaaatggagtg |
34861519 |
T |
 |
| Q |
301 |
atggatgctaaccctattagcaattacagctttggagaagctgaagctttaactgatgaacttgaagagcaatcacaacttgttgctgaggttacgagga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34861518 |
atggatgctaaccctattagcaattacagctttggagaagctgaagctttaactgatgaacttgaagagcaatcacaacttgttgctgaggttacgagga |
34861419 |
T |
 |
| Q |
401 |
ttaaagagattctcaataaccatgaagatgaggtatagtct |
441 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34861418 |
ttaaagagattctcaataaccatgaagatgaggtatagtct |
34861378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University