View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_44 (Length: 311)
Name: NF3547_high_44
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 12 - 292
Target Start/End: Original strand, 34563401 - 34563681
Alignment:
| Q |
12 |
atgaaagatggagtgcattgggtgctggtacacctatactgttaggaaacggcgatgctttgacgcaatattacgttccctatctatcttccattcaaat |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563401 |
atgaaagatggagtgcattgggtgcaggtacacctatactgttaggaaacggcgatgctttgacgcaatattacgttccctatctatcttccattcaaat |
34563500 |
T |
 |
| Q |
112 |
ctataccagtaagtctgttgcagcttctaggtaagccgaacacattactgctcgcttatttaccaaatatgtgtcagcaaaaaggtttgagttttcttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563501 |
ctataccagtaagtctgttgcagcttctaggtaagccgaacacattactgcttgcttatttaccaaatatgtgtcagcaaaaaggtttgagttttcttta |
34563600 |
T |
 |
| Q |
212 |
atcccttcaaggaacaggagagaggataccgatgcagctgaatttgaatttgaatcctcgagtgaagatgatagtggaagc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563601 |
atcccttcaaggaacaggagagaggataccgatgcagctgaatttgaatttgaatcctcgagtgaagatgatagtggaagc |
34563681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University