View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_53 (Length: 296)
Name: NF3547_high_53
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 97 - 286
Target Start/End: Complemental strand, 3415433 - 3415244
Alignment:
| Q |
97 |
tcttctcaggagataatggcactgatttctctgcacatttgatcactgtgaaccatggagaggtatgcaactaatcttacaatttattattccaatatta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3415433 |
tcttctcaggagataatggcactgatttctctgcacatttgatcactgtgaaccatggagaggtatgcaactaatcttataatttattattccaatatta |
3415334 |
T |
|
| Q |
197 |
aaatgtcatatatacaagtaactatcattcacaattttaaaaatttgattacttcataaatttgattgataatgtagactttgatgatgt |
286 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3415333 |
aaatgtcatatatacaagtaattatcattcacgattttaaaaatttgattacttcataaatttgattgataatgtagactttgatgatgt |
3415244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 110 - 163
Target Start/End: Original strand, 4811984 - 4812037
Alignment:
| Q |
110 |
taatggcactgatttctctgcacatttgatcactgtgaaccatggagaggtatg |
163 |
Q |
| |
|
||||||| ||| ||||||| ||||| |||||| |||||||| |||||||||||| |
|
|
| T |
4811984 |
taatggctctggtttctctccacatgtgatcattgtgaaccgtggagaggtatg |
4812037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University