View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_54 (Length: 296)
Name: NF3547_high_54
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 22086414 - 22086675
Alignment:
| Q |
1 |
gatttcgtcctttgtgaatcacaacctggaattgctgggtcatgactcacattttctgaaaatgattttgtcatgcaactgggtttatgaatgtatctgc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22086414 |
gatttcgtcctttgtggatcacaacctggaattgctgggtcatgactcacattttctgaaaatgattttgtcatgcaactgggtttatgaatgtatctgc |
22086513 |
T |
 |
| Q |
101 |
tggacagatatcactttggtagtgtgggtttctttggtgtatcatgagttgtgttttctttggtgttgaaacagtgcattagtaagggaagatgagcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22086514 |
tggacagatatcactttggtagtgtgggtttctttggtgtatcatgagttgtgttttctttggtgttgaaacggtgcattagtaagggaagatgagcagc |
22086613 |
T |
 |
| Q |
201 |
aacaacagtcactttggaaaatttggtgacagaactctaccttcatatcagactcttcacac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22086614 |
aacaacagtcactttggaaaatttggtgacagaactctaccttcatatcagactcttaacac |
22086675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University