View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_57 (Length: 283)
Name: NF3547_high_57
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 23 - 267
Target Start/End: Original strand, 782842 - 783086
Alignment:
| Q |
23 |
aacattcatcaacaacatggcaatggcaactcaagcctctctcttcactccacctctttcaagccctaaaccatggaaacaaccatcaactttatccttc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782842 |
aacattcatcaacaacatggcaatggcaactcaagcctctctcttcactccacctctttcaagccctaaaccatggaaacaaccatcaactttatccttc |
782941 |
T |
 |
| Q |
123 |
atctctctcaaacccatcaagttcacaacaaaaacaacaaaaatctcagctgcagatgagaaaacagaagcagcatcagttacaacaaaagaagaagctc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782942 |
atctctctcaaacccatcaagttcacaacaaaaacaacaaaaatctcagctgcagatgagaaaacagaagcagcatcagttacaacaaaagaagaagctc |
783041 |
T |
 |
| Q |
223 |
ctgctgcaccagttggtttcactccacctgaactagacccaaaca |
267 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
783042 |
ctgctgcaccagttggttttactccacctgaactagacccaaaca |
783086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University