View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_58 (Length: 274)
Name: NF3547_high_58
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 67 - 270
Target Start/End: Complemental strand, 20750837 - 20750634
Alignment:
| Q |
67 |
ttattgatgtaaccacgactttgtggtggtatgataaactcttaaggttgtgccgccatcaaaccaacatgtggtcactcaacgccaacatcatcatttc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20750837 |
ttattgatgtaaccacgactttgtggtggtgtgataaactcttaaggttgtgtcgccatgaaaccaacatggggtcactcaacgccaacatcatcatttc |
20750738 |
T |
 |
| Q |
167 |
ttgccatggtagctcccaaaatgcgtttgtgtttgtttgatgatcaaccctttgtttttgtctaagcataaaccatgttagtgttcttcaatttgttcat |
266 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20750737 |
ttgccatggtagctcccaaaatgcttttgtgtttgtttgatgatcaaccctttgtttttgtctaagcataaaccatgttagtgttcttcaatttgttcat |
20750638 |
T |
 |
| Q |
267 |
ggtg |
270 |
Q |
| |
|
|||| |
|
|
| T |
20750637 |
ggtg |
20750634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 61 - 101
Target Start/End: Complemental strand, 16748746 - 16748706
Alignment:
| Q |
61 |
caatttttattgatgtaaccacgactttgtggtggtatgat |
101 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16748746 |
caattgttactgatgtaaccacgactttgtggtggtgtgat |
16748706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University