View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_63 (Length: 261)
Name: NF3547_high_63
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 6 - 244
Target Start/End: Complemental strand, 16910973 - 16910735
Alignment:
| Q |
6 |
tgaacgagaccacgtgttagagatatagaattaaggtttggagtagaaagcacaactttgtaacgttccggagcggtaaaacctatggacaaactatata |
105 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||| ||| |
|
|
| T |
16910973 |
tgaacgagaccacgaaagagagagatagaattaaggtttggagtagaaagcacaactttgtaacgttccggaggggtacaacctatgcacaaactagata |
16910874 |
T |
|
| Q |
106 |
gcttggaattagatatgcagaggacagttgcattgtgttgtagacaccaacagtcaagaaccaaggtgcttaacatcttaaaatttgaaaagggttccac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910873 |
gcttggaattagatatgcagaggacagttgcattgtgttgtagagaccaacagttaaggaccaaagtgcttaacatcttaaaatttgaaaagggttccac |
16910774 |
T |
|
| Q |
206 |
aatgccattatcatttgcaacaaaagtgacagagataag |
244 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
16910773 |
aatgccattgtcatttgcaacaaaagtggcagagataag |
16910735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University