View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3547_high_65 (Length: 259)

Name: NF3547_high_65
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3547_high_65
NF3547_high_65
[»] chr4 (1 HSPs)
chr4 (1-244)||(31098416-31098659)


Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 31098659 - 31098416
Alignment:
1 aagagaggatgagcaggtggttgcgaaggcagtgggagattgtgaccaaggagggagtattttttgcatcttgatggaggtctgttgcaacaaggtaaag 100  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||    
31098659 aagagaggatgagcaggtggttgcaaaggcagtgggagattgtgaccaaggagggagtaatatttgcatcttgatggaggtctgttgcaacgaggtaaag 31098560  T
101 ccacgagttttaagaaaatgagagctatgtactgcgagaagagaaagatgcgtttgtttgagatggcttattattgaagaagtcacgaccatgagatggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31098559 ccacgagttttaagaaaatgagagctatgtactgcgagaagagaaagatgcgtttgtttgagatggcttattattgaagaagtcacgaccatgagatggt 31098460  T
201 gttgggagaagaccgtctttgccgccgcagcattgcaaaatttg 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
31098459 gttgggagaagaccgtctttgccgccgcagcattgcaaaatttg 31098416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University