View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3547_high_79 (Length: 239)

Name: NF3547_high_79
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3547_high_79
NF3547_high_79
[»] chr3 (2 HSPs)
chr3 (1-63)||(45609045-45609107)
chr3 (156-222)||(45609200-45609266)


Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 45609045 - 45609107
Alignment:
1 ttgatttgctcttcacgagtccgccttgtttgtgaaacaaaaagatggaagaagtctttccct 63  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45609045 ttgatttgctcttcacgagtccgccttgtttgtgaaacaaaaagatggaagaagtctttccct 45609107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 156 - 222
Target Start/End: Original strand, 45609200 - 45609266
Alignment:
156 caacaggatgaggttgttttttgagagctagaactagaagatgtggataattgatcaagcttatctt 222  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
45609200 caacaggatgaggttgttttttgagagctataactagaagatgtggataattgatcaagcttatctt 45609266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University