View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_high_88 (Length: 235)
Name: NF3547_high_88
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_high_88 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 6943923 - 6943695
Alignment:
| Q |
7 |
ggaatcatcagcaccgaaaccatacaagtatgatccattactgaggtagcaggtgtgagggatacgaaggacctctctagttgtcgggttaaagatggct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
6943923 |
ggaatcatcagcaccgaaaccatacaagtatgatccattactgaggtagcaggtgtgagggatacgatggacctctctagttgtcgggttcaagatggct |
6943824 |
T |
|
| Q |
107 |
aactcatttacacaactattatacaaacacaaacctttgagacaaaaaacaccgttacaactaccttccattgttatgggataatgagaattgttggaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6943823 |
aactcatttacacaactattataccaacagaaacctttgagacaaaaaacaccgttacaaataccttccattgttatgggataatgagaattgttggaaa |
6943724 |
T |
|
| Q |
207 |
agggggatttgatgtgtattaggttgtca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6943723 |
agggggatttgatgtgtattaggttgtca |
6943695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 125 - 235
Target Start/End: Original strand, 7475392 - 7475508
Alignment:
| Q |
125 |
ttatacaaacacaaacctttgagacaaaaaacaccgttacaactacc------ttccattgttatgggataatgagaattgttggaaaagggggatttga |
218 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||| || ||||||| ||| |||||||| || | ||| || ||| |||||||||||||||||| |
|
|
| T |
7475392 |
ttataccaacacaaacctttgagacagaaaacaccattgaaactaccatatgattcaattgttataggttgatgggagttgctggaaaagggggatttga |
7475491 |
T |
|
| Q |
219 |
tgtgtattaggttgtca |
235 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
7475492 |
tgtgcattaggttgtca |
7475508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University