View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_low_32 (Length: 363)
Name: NF3547_low_32
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 112 - 347
Target Start/End: Complemental strand, 37366751 - 37366517
Alignment:
| Q |
112 |
gaatcagaaattctggcgtgtagattgaaataatagagcatatctaagaggttcaagtattcattggtgcaatggttgaaaaatcatagaacttgtctag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37366751 |
gaatcagaaattctggcgtgtagattgaaata---gagcatatctaagaggttcaagtattcattggtgcaatggttgaaaaatcatagaccttgtctag |
37366655 |
T |
 |
| Q |
212 |
agtctacaacactggtgtgcagacaaaagtcataacataaac--tattgtgcaacttctataaatccatttacaatatggttgaagttgtgatacattgg |
309 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37366654 |
agtctacaacattggtgtgcagacaaaagtcataacataaactatattgtgcaacttctataaatccatttacaatatggttgaagttgtgatacattgg |
37366555 |
T |
 |
| Q |
310 |
ctctgacttgcttgaattatgtgcgttaggttttgatg |
347 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37366554 |
ctctgacttggttgaattatgtgcgttaggttttgatg |
37366517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 37366802 - 37366751
Alignment:
| Q |
30 |
ggacgttggacaacgtagaaattaaggaatcaaagatttttaaatgagaagg |
81 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37366802 |
ggactttggacaacgtagaaattaaggaatcaaagatttttaaatgagaagg |
37366751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University