View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_low_69 (Length: 253)
Name: NF3547_low_69
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_low_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 251
Target Start/End: Complemental strand, 38630347 - 38630116
Alignment:
| Q |
20 |
ctctaacaggtggccatacccatttcttgagcttaatattccatgggctcccttatggtaagatatactattaacatacaaatgccatgtcttctccatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38630347 |
ctctaacaggtggccatacccatttcttgagcttaatattccatgggctcccttatggtaagatatactattaacatacaaatgccatgtcttctccatt |
38630248 |
T |
|
| Q |
120 |
tttctttctatacaaaatacttgttattctcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgctacggcatctattc |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38630247 |
tttctttctataccaaatacttgttattctcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgctacggcatctattc |
38630148 |
T |
|
| Q |
220 |
attgatagtgaaaaccaaaatcaatattcttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38630147 |
attgatagtgaaaaccaaaatcaatattcttc |
38630116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 232
Target Start/End: Original strand, 38695745 - 38695825
Alignment:
| Q |
149 |
tcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgctacggcatctattcattgatagtgaaa |
232 |
Q |
| |
|
|||| |||| ||| |||||||||| |||||| | ||||||||||||||||| ||||||| ||| |||| ||||||||||||| |
|
|
| T |
38695745 |
tcaccaatgcatcgtgtctatagg---atctgccttgcgctagttcacataccctgctacgacatgtatttattgatagtgaaa |
38695825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University