View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3547_low_72 (Length: 248)
Name: NF3547_low_72
Description: NF3547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3547_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 21 - 236
Target Start/End: Complemental strand, 38279921 - 38279722
Alignment:
| Q |
21 |
ataacgtgaattattcgtactagtgcatatgttattttttgtacggcttttaaaaatgagtaaagtagtaaatttgaggcacaaggggatatatgctttc |
120 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38279921 |
ataacgtgaattattcgtaccagtgcatatgttattttttgtacggcttttaaaaatgag------------------gcacaaggggatatatgctttc |
38279840 |
T |
 |
| Q |
121 |
actttgcaaatttg-cttttat-gttgctttgtctcattgagattcttttatcacatacataattgctggacagtatcatctcgaggcatctcaatcctc |
218 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38279839 |
actttgcaaatttgtcttttattgttgctttgtctcattgagattcttttatcacatacataattgctggacagtatcatctcgaggcatctcaatcctc |
38279740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University